Words similar to catch
- catactacagtgacgtggac
- catastrophic
- catastrophically
- catatg
- catatonic
- catawba
- catastrophes
- cataño
- catbert
- catbird
- catbrain
- catcalls
- catcgaccattgttctctctcc
- catcgat
- catch
- catch-
- catch--or
- catch-all
- catch-and-release
- catch-as-catch-can
- catcher
- catchers
- catches
- catching
- catctgcagcatccatatgactgcatccctc-
- categories
- category
- catg
- catgaatctggctg
Example sentences for: catch
How can you use “catch” in a sentence? Here are some example sentences to help you improve your vocabulary:
"COMING IN AND OUT OF THE COLD" --You could catch your death.
However, if memory serves me, the 1981 raise was designed to provide a "catch up" to bring military pay back to parity with civilian wages after a decade of lagging pay increases.
Right now, something called the Dog Genome Project is trying to isolate the various genes for breed-specific behaviors, including the basenji's genetic reluctance to bark and the basset's genetic refusal to catch Frisbees.
Catch you then, Johnette
The catch: He will borrow that money from Bob Dole.
Loading...