Words similar to catactacagtgacgtggac

Example sentences for: catactacagtgacgtggac

How can you use “catactacagtgacgtggac” in a sentence? Here are some example sentences to help you improve your vocabulary:

A 169-base-pair DNA fragment of the factor V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward primer 5'CATACTACAGTGACGTGGAC3' and the reverse primer 5'GACCTAACATGTTCTAGCCAGAAG3'.