Words similar to cataagtgttgcggaagtaa
Example sentences for: cataagtgttgcggaagtaa
How can you use “cataagtgttgcggaagtaa” in a sentence? Here are some example sentences to help you improve your vocabulary:
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
Loading...