Words similar to catastrophic
- cat-scan
- cataacgccagcccacctactg-
- cataagtgttgcggaagtaa
- cataataat
- catactacagtgacgtggac
- catarino
- catarrh
- catarrhini
- catastrophe
- catastrophe--for
- catastrophe--such
- catastrophe-free
- catastrophe-unfolding
- catastrophes
- catastrophic
- catastrophically
- catatg
- catatonic
- catawba
- catastrophes
- cataño
- catbert
- catbird
- catbrain
- catcalls
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
Example sentences for: catastrophic
How can you use “catastrophic” in a sentence? Here are some example sentences to help you improve your vocabulary:
Since then, GAO has used the increased risk of uncontrollable and often catastrophic wildfires as an example of the need for "strategic budgeting" to address issues that are not aligned with the current budget and organizational structures of the four major federal land management agencies.
However, before such catastrophic effects, low national saving would probably result in higher interest rates, rising inflation, and the increasing reluctance of foreign investors to lend to a weakening U.S. economy.
Recommendation: Since a catastrophic attack could occur with little or no notice, we should minimize as much as possible the disruption of national security policymaking during the change of administrations by accelerating the process for national security appointments.
This new catastrophic risk protection level of insurance was mandated by the Federal Crop Insurance Reform Act of 1994 (P.L.
Ultimately, the accumulation of nuclear inclusions in cells expressing Rab24(D123I) causes a catastrophic disruption of the nuclear architecture, although this does not appear to be accompanied by classic signs of apoptotic cell death such as DNA fragmentation or caspase activation.