Words similar to category
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- categorical
- categories
- categorization
- categorizations
- categorize
- categorized
- categorizes
- categorizing
- category
- category-
- category--
- category--a
- category--and
- category--both
- catenation
- catenin
- catera
- cateress
- caterina
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
- catgctgtcctcgacctgggc-
Example sentences for: category
How can you use “category” in a sentence? Here are some example sentences to help you improve your vocabulary:
We applied a test that corrected for regional gene density, and found substantial evidence for regional clustering among the transcripts belonging to the same category (see additional data files for location plotsfor the top 60 ontological categories).
That is 0.5 kids more than the upper-middle-class average and the same number as the lowest census income category.
Everybody understands the concept of an adults-only category.
Several research groups around the world have worked on vaccine development—and their efforts have been boosted by the classification of Lassa virus as a Category A bioweapons agent—but to date no vaccine is available for either general or high-risk application in humans.
Ronald Reagan's apology to World War II-era Japanese internees falls into this category, as does the Vatican's apology to victims of the Holocaust.