Words similar to category
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- categorical
- categories
- categorization
- categorizations
- categorize
- categorized
- categorizes
- categorizing
- category
- category-
- category--
- category--a
- category--and
- category--both
- catenation
- catenin
- catera
- cateress
- caterina
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
- catgctgtcctcgacctgggc-
Example sentences for: category
How can you use “category” in a sentence? Here are some example sentences to help you improve your vocabulary:
Now you must figure out if you are in that category.
In the comparative modelling category, we made 29 predictions for targets that had sequence identities ranging from 50% to 10% to the nearest related protein with known structure.
This is a departure from the VPA pattern, and is consistent across category with a color/concentration positive relationship.
The equation for the basic category has prices in it, with the understanding that the mailers look at the prices and decide how much mail to send.
Patients whose sleep patterns improved at least one category exhibited a 32% reduction in Tinnitus Severity Index score on the follow-up questionnaire.
Loading...