Words similar to category
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- categorical
- categories
- categorization
- categorizations
- categorize
- categorized
- categorizes
- categorizing
- category
- category-
- category--
- category--a
- category--and
- category--both
- catenation
- catenin
- catera
- cateress
- caterina
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
- catgctgtcctcgacctgggc-
Example sentences for: category
How can you use “category” in a sentence? Here are some example sentences to help you improve your vocabulary:
Under the null hypothesis, the transcripts in a category should be distributed uniformly among all mapped transcripts with ontological classification, and the successive distances are approximately truncated exponential.
So-called "commuter aliens" are a special category of lawful permanent residents recognized by the INS regulations as resident aliens of the United States who may reside outside of the United States in a contiguous territory and who return to work in the United States regularly.
All of the so-called intraepithelial neoplasias fall into this category.
The BTBD proteins belong to the last category, although they are distantly related to kelch proteins (~25% identical over ~250 aa), they lack the residues that are characteristic of kelch repeats, a double glycine sequence and a tyrosine separated from a tryptophan by precisely 6 residues [ 35 37 ] .
Gene expression changes within the Cellular Matrix Organization and Adhesion category were focused on extracellular matrix genes and cellular adhesion molecules (Figure 4Cand Table 5).
Loading...