Words similar to categories
- catatg
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- catechism
- catecholamine
- catecholamine-
- catechole
- catedral
- categoric
- categorical
- categorically
- categoricvariables
- categories
- categories--
- categories--became
- categories--docile
- categories--health
- categories--plus
- categorization
- categorize
- categorizing
- category
- catenation
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
Example sentences for: categories
How can you use “categories” in a sentence? Here are some example sentences to help you improve your vocabulary:
Recently, the Grammies have become more current by adding categories, and they have begun to repay artists for years of neglect.
Three of the new sets of rules prescribe expedited procedures for particular categories of Postal Service requests.
The groupings suggested by the phenogram are based on sequence similarity across the entire alignment, which may suggest categories different from those suggested by considerations of much smaller stretches of residues known to be important for the characteristic functional features of a particular subfamily.
At the same time, there are at least four categories of benefits.
This assumes that these pattern of use categories have the same meaning to cases and controls with respect to quantity of water consumed, which may not be the true.
Loading...