Words similar to categories
- catatg
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- catechism
- catecholamine
- catecholamine-
- catechole
- catedral
- categoric
- categorical
- categorically
- categoricvariables
- categories
- categories--
- categories--became
- categories--docile
- categories--health
- categories--plus
- categorization
- categorize
- categorizing
- category
- catenation
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
Example sentences for: categories
How can you use “categories” in a sentence? Here are some example sentences to help you improve your vocabulary:
6 Under current law, LSC recipients may provide legal assistance to an alien if the alien is present in the United States and falls within one of several designated categories:
Standard emission rates are set forth for three categories of units: coal-fired units; oil-fired units; and other units.
Buchnera is a mutualistic endosymbiont of its host, but the pattern of reductions of numbers of genes among functional categories is similar between Buchnera and other fully sequenced small-genome bacteria, all obligate pathogens [ 8, 12, 15, 16].
Any point you failed to win by rigging the questions and categories can be cleaned up in the "executive summary" (the pollster's spin) and the press release and news conference (the client's spin on the pollster's spin).
Using these values, there is high confidence that genes assigned into the three categories are accurate.