Words similar to categories
- catatg
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- catechism
- catecholamine
- catecholamine-
- catechole
- catedral
- categoric
- categorical
- categorically
- categoricvariables
- categories
- categories--
- categories--became
- categories--docile
- categories--health
- categories--plus
- categorization
- categorize
- categorizing
- category
- catenation
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
Example sentences for: categories
How can you use “categories” in a sentence? Here are some example sentences to help you improve your vocabulary:
When the main diagnostic categories in our database are compared with those in the development database of APACHE II, some interesting differences appear.
There are certain categories of control activities that are common to all agencies.
For an alien in one of the unrestricted categories representation would be authorized so long as the eligible alien is present sufficient to maintain residence or lawful immigration status.
The two broadest categories are genetic sex determination (GSD), in which the sex of offspring is set by a sex chromosome or an autosomal gene, and environmental sex determination (ESD), in which sex is determined by temperature (as with turtles), local sex ratio (as with some tropical fish), or population density (as with mermithid nematodes).
1. Unrestricted Categories
Loading...