Words similar to categories
- catatg
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- catechism
- catecholamine
- catecholamine-
- catechole
- catedral
- categoric
- categorical
- categorically
- categoricvariables
- categories
- categories--
- categories--became
- categories--docile
- categories--health
- categories--plus
- categorization
- categorize
- categorizing
- category
- catenation
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
Example sentences for: categories
How can you use “categories” in a sentence? Here are some example sentences to help you improve your vocabulary:
There are three primary categories of methods for predicting protein structure from sequence: comparative modelling, fold recognition, and ab initio prediction.
Puzzle solvers seem to fall into two categories, those who use reference books to help them find the right answers and those who eschew any aids whatsoever.
It does it the old-fashioned way, hiring people to look at each site and assign it an abstract and one or more categories.
Of particular interest to the Commission was the situation of seasonal agricultural workers, a category that includes both aliens from the unrestricted categories (such as permanent resident aliens) and H-2A workers.
For analysis, duration of fish consumption was categorized into four categories: none, 1-2, 3-7, and 8+ years.
Loading...