Words similar to categories
- catatg
- catcgaccattgttctctctcc
- catcgat
- catch
- catctgcagcatccatatgactgcatccctc-
- catechism
- catecholamine
- catecholamine-
- catechole
- catedral
- categoric
- categorical
- categorically
- categoricvariables
- categories
- categories--
- categories--became
- categories--docile
- categories--health
- categories--plus
- categorization
- categorize
- categorizing
- category
- catenation
- catg
- catgaatctggctg
- catgagaatgcctccaaaca
- catgctctgacagagttcg-
Example sentences for: categories
How can you use “categories” in a sentence? Here are some example sentences to help you improve your vocabulary:
Each of these base pair categories has a unique color code in the illustrations on the "RNA Structure Definitions" page, which provides multiple examples of each category from the 16S and 23S rRNA structure models.
All of these introns do not fall into either the group I and group II categories; however, two notable groups of introns are included within the "Unclassified" category.
Standard emission rates are established for three categories of units: coal-fired units; oil-fired units; and other units.
First, it would eliminate the "preferred" categories of mail, all of which have rates that are below corresponding commercial rates.
On the basis of HCFA definitions, two major categories of rural hospitals were identified.
Loading...