Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Because the proportion of incidental detection among cases undergoing a TURP was not associated with age, we multiplied in each age category for each year 1985 through 1997 the proportion 0.6786 by the total number of age- and year-specific TURPs recorded among cases to get an estimate of the number of TURPs that led to a prostate cancer diagnosis.
The Member and Statistical Records Department of the LDS Church provided annual age- and sex-specific estimates of the number of LDS Church members in Utah (Larry Elkington, Manager of Church Management Information Center, personal communication).
To determine the effects of decreased Bmp4 gene dosage on intraocular pressure, we compared the lOPs of age- and strain-matched
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.