Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
This skewed T-cell phenotype was not found in healthy age- and sex-matched control individuals or in patients with SLE.
In tissues such as the hypothalamus, where we see large differences in gene expression in age- and sex-matched mice of the same strain, this variability may reflect high levels of variability in behavior that are seen in inbred mice raised and tested under seemingly identical laboratory conditions [ 50 ] .
Patient profiles and characteristics are shown in Table 1. Age- and sex-matched healthy control groups were included for the RA and the SLE patient groups (control group for RA: n = 8, age range 32-61 years [mean 50 years]; and control group for SLE: n = 12, age range 22-61 years [mean 46 years]).
Although no studies to our knowledge have addressed the question directly, the limited body of data on expression profiling of age- and sex-matched humans generally reports significant variation in gene expression among individuals [ 25 26 27 ] , although little of these data are publicly available.
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
Loading...