Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.
To determine the effects of decreased Bmp4 gene dosage on intraocular pressure, we compared the lOPs of age- and strain-matched
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
These samples showed a correlation coefficient of 0.782 when all tags were considered or 0.500 when highly abundant tags were excluded, a high value for cumulative p -value differences (Figure 4), and large numbers of tag differences (Figure 5g), suggesting that pronounced variation in gene expression is found even in genetically identical age- and sex-matched individuals housed in similar laboratory environments.
Although no studies to our knowledge have addressed the question directly, the limited body of data on expression profiling of age- and sex-matched humans generally reports significant variation in gene expression among individuals [ 25 26 27 ] , although little of these data are publicly available.