Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
5B (library construction from ditag stage); Additional data file 3- crx +/+A vs crx +/+B (library construction from mRNA stage); Additional data file 4- 41-year-old peripheral retina and 44-year-old peripheral retina (individual/environmental variation); Additional data file 5- 44-year-old peripheral retina and 88-year-old peripheral retina (individual variation/age- and sex-dependent gene expression); Additional data file 6- P6.
While many studies have examined expression in inbred mice, the extent of variation in gene expression in age- and sex-matched individuals is rarely addressed.
Loading...