Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
To determine the effects of decreased Bmp4 gene dosage on intraocular pressure, we compared the lOPs of age- and strain-matched
The Member and Statistical Records Department of the LDS Church provided annual age- and sex-specific estimates of the number of LDS Church members in Utah (Larry Elkington, Manager of Church Management Information Center, personal communication).
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
[ 5, 14, 15] Age- and sex-standardized and stratified incidence rates of total stroke were also estimated.
There are, however, several published microarray experiments in which, although individual variation in gene expression was not explicitly addressed, variation in gene expression in age- and sex-matched individual mice or pooled samples of three or fewer mice was measured and found to be relatively small [ 36 37 38 39 ] . These include data from both peripheral tissue and brain that reported r -values for individual mice at around 0.98 [ 37 38 ] , and one publicly available dataset of inter-individual comparisons of CNS tissues [ 38 ] . We analyzed this dataset and found it to have correlation coefficients in the 0.97-0.
Loading...