Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
The Member and Statistical Records Department of the LDS Church provided annual age- and sex-specific estimates of the number of LDS Church members in Utah (Larry Elkington, Manager of Church Management Information Center, personal communication).
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.
To determine the effects of decreased Bmp4 gene dosage on intraocular pressure, we compared the lOPs of age- and strain-matched
While many studies have examined expression in inbred mice, the extent of variation in gene expression in age- and sex-matched individuals is rarely addressed.
Loading...