Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
There are, however, several published microarray experiments in which, although individual variation in gene expression was not explicitly addressed, variation in gene expression in age- and sex-matched individual mice or pooled samples of three or fewer mice was measured and found to be relatively small [ 36 37 38 39 ] . These include data from both peripheral tissue and brain that reported r -values for individual mice at around 0.98 [ 37 38 ] , and one publicly available dataset of inter-individual comparisons of CNS tissues [ 38 ] . We analyzed this dataset and found it to have correlation coefficients in the 0.97-0.
This skewed T-cell phenotype was not found in healthy age- and sex-matched control individuals or in patients with SLE.
Patient profiles and characteristics are shown in Table 1. Age- and sex-matched healthy control groups were included for the RA and the SLE patient groups (control group for RA: n = 8, age range 32-61 years [mean 50 years]; and control group for SLE: n = 12, age range 22-61 years [mean 46 years]).
Because the proportion of incidental detection among cases undergoing a TURP was not associated with age, we multiplied in each age category for each year 1985 through 1997 the proportion 0.6786 by the total number of age- and year-specific TURPs recorded among cases to get an estimate of the number of TURPs that led to a prostate cancer diagnosis.
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.
Loading...