Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.
, overweight: 25 kg/m 2< BMI < 30 kg/m 2; obese: BMI ≥ 30 kg/m 2) and an age- and gender-weighted chronic disease score (CDS) [ 15 ] based on the presence or absence of 29 specific comorbidities determined from pharmacy dispensing data.
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
In tissues such as the hypothalamus, where we see large differences in gene expression in age- and sex-matched mice of the same strain, this variability may reflect high levels of variability in behavior that are seen in inbred mice raised and tested under seemingly identical laboratory conditions [ 50 ] .
Loading...