Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Although no studies to our knowledge have addressed the question directly, the limited body of data on expression profiling of age- and sex-matched humans generally reports significant variation in gene expression among individuals [ 25 26 27 ] , although little of these data are publicly available.
Because the proportion of incidental detection among cases undergoing a TURP was not associated with age, we multiplied in each age category for each year 1985 through 1997 the proportion 0.6786 by the total number of age- and year-specific TURPs recorded among cases to get an estimate of the number of TURPs that led to a prostate cancer diagnosis.
5B (library construction from ditag stage); Additional data file 3- crx +/+A vs crx +/+B (library construction from mRNA stage); Additional data file 4- 41-year-old peripheral retina and 44-year-old peripheral retina (individual/environmental variation); Additional data file 5- 44-year-old peripheral retina and 88-year-old peripheral retina (individual variation/age- and sex-dependent gene expression); Additional data file 6- P6.
Patient profiles and characteristics are shown in Table 1. Age- and sex-matched healthy control groups were included for the RA and the SLE patient groups (control group for RA: n = 8, age range 32-61 years [mean 50 years]; and control group for SLE: n = 12, age range 22-61 years [mean 46 years]).
Six groups of five male, age- and weight-matched, Sprague-Dawley rats were separated into three groups of vehicle controls and three groups of CCl 4 -treated animals.
Loading...