Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Kleinfeld and coworkers [ 27 ] demonstrated that elderly women were more vulnerable to hypokalemia, and indicated that this was possibly due to age- and sex-associated differences in body mass composition, which might result in a physiologically low total exchangeable body potassium.
5B (library construction from ditag stage); Additional data file 3- crx +/+A vs crx +/+B (library construction from mRNA stage); Additional data file 4- 41-year-old peripheral retina and 44-year-old peripheral retina (individual/environmental variation); Additional data file 5- 44-year-old peripheral retina and 88-year-old peripheral retina (individual variation/age- and sex-dependent gene expression); Additional data file 6- P6.
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.