Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
Patient profiles and characteristics are shown in Table 1. Age- and sex-matched healthy control groups were included for the RA and the SLE patient groups (control group for RA: n = 8, age range 32-61 years [mean 50 years]; and control group for SLE: n = 12, age range 22-61 years [mean 46 years]).
In tissues such as the hypothalamus, where we see large differences in gene expression in age- and sex-matched mice of the same strain, this variability may reflect high levels of variability in behavior that are seen in inbred mice raised and tested under seemingly identical laboratory conditions [ 50 ] .
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
The high reliability of microSAGE data revealed in these analyses allows us to report the first comprehensive profiles of levels of difference in gene expression observed among tissues obtained from age- and sex-matched individuals.
Loading...