Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
While many studies have examined expression in inbred mice, the extent of variation in gene expression in age- and sex-matched individuals is rarely addressed.
Because the proportion of incidental detection among cases undergoing a TURP was not associated with age, we multiplied in each age category for each year 1985 through 1997 the proportion 0.6786 by the total number of age- and year-specific TURPs recorded among cases to get an estimate of the number of TURPs that led to a prostate cancer diagnosis.
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
[ 5, 14, 15] Age- and sex-standardized and stratified incidence rates of total stroke were also estimated.