Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Six groups of five male, age- and weight-matched, Sprague-Dawley rats were separated into three groups of vehicle controls and three groups of CCl 4 -treated animals.
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
In tissues such as the hypothalamus, where we see large differences in gene expression in age- and sex-matched mice of the same strain, this variability may reflect high levels of variability in behavior that are seen in inbred mice raised and tested under seemingly identical laboratory conditions [ 50 ] .
In the context of the diabetic milieu and diabetic complications, our findings provide new molecular insights into diabetes-induced AGE- and FFA-dependent injury of renal epithelial cells.
This skewed T-cell phenotype was not found in healthy age- and sex-matched control individuals or in patients with SLE.
Loading...