Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
Six groups of five male, age- and weight-matched, Sprague-Dawley rats were separated into three groups of vehicle controls and three groups of CCl 4 -treated animals.
In tissues such as the hypothalamus, where we see large differences in gene expression in age- and sex-matched mice of the same strain, this variability may reflect high levels of variability in behavior that are seen in inbred mice raised and tested under seemingly identical laboratory conditions [ 50 ] .
, overweight: 25 kg/m 2< BMI < 30 kg/m 2; obese: BMI ≥ 30 kg/m 2) and an age- and gender-weighted chronic disease score (CDS) [ 15 ] based on the presence or absence of 29 specific comorbidities determined from pharmacy dispensing data.
This skewed T-cell phenotype was not found in healthy age- and sex-matched control individuals or in patients with SLE.
While many studies have examined expression in inbred mice, the extent of variation in gene expression in age- and sex-matched individuals is rarely addressed.
Loading...