Words similar to age-
- agathe-des-
- agavachado
- agave
- agawan
- agayne
- agc
- agctcagggagtacttcaaga
- agctg-
- agctgaattccacaaactttaataaatccgaaac-
- agctgcggccgccctgaaccggttgggtgccac-
- agctggccctggcactgctctgctct
- age
- age-
- age--
- age--a
- age--but
- age--we
- age-adjusted
- age-appropriate
- age-bsa
- age-bsa-
- age-bsa-induced
- age-specific
- age-stratified
- agei
- agencies
- agency
Example sentences for: age-
How can you use “age-” in a sentence? Here are some example sentences to help you improve your vocabulary:
[ 5, 14, 15] Age- and sex-standardized and stratified incidence rates of total stroke were also estimated.
These samples showed a correlation coefficient of 0.782 when all tags were considered or 0.500 when highly abundant tags were excluded, a high value for cumulative p -value differences (Figure 4), and large numbers of tag differences (Figure 5g), suggesting that pronounced variation in gene expression is found even in genetically identical age- and sex-matched individuals housed in similar laboratory environments.
Age- and stage-shifts in the data are also consistent with higher levels of screening among LDS men.
This skewed T-cell phenotype was not found in healthy age- and sex-matched control individuals or in patients with SLE.
On the other hand, the clinical and physiological features of anaphylaxis elicited by the G7 peptides were similar to those observed in age- and gender-matched NOD mice undergoing IgE-mediated passive systemic anaphylaxis (Fig.