Words similar to agctcagggagtacttcaaga

Example sentences for: agctcagggagtacttcaaga

How can you use “agctcagggagtacttcaaga” in a sentence? Here are some example sentences to help you improve your vocabulary:

Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.