Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

Well, now the Star has revealed that the PPC is Texas Gov.
Finally, the ppc gene product was required for the anaerobic synthesis of oxaloacetate and α-ketoglutarate, but the in silico analysis suggests that this gene product is not essential for growth in aerobic conditions where the glyoxylate by-pass has the potential to replenish the biosynthetic precursors [ 29].
The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.
31 / ppc).
N-terminal deletions, in addition to the series obtained through two-hybrid screening, were constructed by amplifying the two-hybrid cDNA clones using primers containing Sma I and EcoR I at the N- and C-terminus, respectively, and inserting them into both pPC86 and pGEX-2TK vectors.