Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

This can be restated in terms of V / P, or pieces per capita (ppc), as:
A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.
31 / ppc).
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).
Finally, the ppc gene product was required for the anaerobic synthesis of oxaloacetate and α-ketoglutarate, but the in silico analysis suggests that this gene product is not essential for growth in aerobic conditions where the glyoxylate by-pass has the potential to replenish the biosynthetic precursors [ 29].