Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • 31 / ppc).

  • Finally, the ppc gene product was required for the anaerobic synthesis of oxaloacetate and α-ketoglutarate, but the in silico analysis suggests that this gene product is not essential for growth in aerobic conditions where the glyoxylate by-pass has the potential to replenish the biosynthetic precursors [ 29].

  • This can be restated in terms of V / P, or pieces per capita (ppc), as:

  • A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).

  • A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast