Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.
31 / ppc).
N-terminal deletions, in addition to the series obtained through two-hybrid screening, were constructed by amplifying the two-hybrid cDNA clones using primers containing Sma I and EcoR I at the N- and C-terminus, respectively, and inserting them into both pPC86 and pGEX-2TK vectors.
Additionally, several LO non-essential gene products were essential ( sdhABCD, ppc, frdABCD ) for growth within other phases.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).