Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.
To construct the GST-fusion protein expression vectors, the BTBD inserts from the prey vector pPC86 were amplified using primers complementary to the BTBD coding regions with additional Sma I and EcoR I restriction sites for insertion into these sites in pGEX-2TK (Pharmacia).
N-terminal deletions, in addition to the series obtained through two-hybrid screening, were constructed by amplifying the two-hybrid cDNA clones using primers containing Sma I and EcoR I at the N- and C-terminus, respectively, and inserting them into both pPC86 and pGEX-2TK vectors.
The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.
This can be restated in terms of V / P, or pieces per capita (ppc), as: