Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Well, now the Star has revealed that the PPC is Texas Gov.

  • This can be restated in terms of V / P, or pieces per capita (ppc), as:

  • To construct the GST-fusion protein expression vectors, the BTBD inserts from the prey vector pPC86 were amplified using primers complementary to the BTBD coding regions with additional Sma I and EcoR I restriction sites for insertion into these sites in pGEX-2TK (Pharmacia).

  • A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.

  • A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast