Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Additionally, several LO non-essential gene products were essential ( sdhABCD, ppc, frdABCD ) for growth within other phases.

  • The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.

  • A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.

  • 31 / ppc).

  • Finally, the ppc gene product was required for the anaerobic synthesis of oxaloacetate and α-ketoglutarate, but the in silico analysis suggests that this gene product is not essential for growth in aerobic conditions where the glyoxylate by-pass has the potential to replenish the biosynthetic precursors [ 29].


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast