Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.
To construct the GST-fusion protein expression vectors, the BTBD inserts from the prey vector pPC86 were amplified using primers complementary to the BTBD coding regions with additional Sma I and EcoR I restriction sites for insertion into these sites in pGEX-2TK (Pharmacia).
Additionally, several LO non-essential gene products were essential ( sdhABCD, ppc, frdABCD ) for growth within other phases.
The fragment, corresponding to -127 to +62 relative to the start of transcription, was amplified by PCR using primers 5'GAACGGTCTAGAATATATTGGC'3 (oSB15) and 5'GGGAATTCGCTATATAGGCTTGTATACATCGAA'3 (oSB14) with plasmid pPC25 as template.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).