Words similar to ppc

Example sentences for: ppc

How can you use “ppc” in a sentence? Here are some example sentences to help you improve your vocabulary:

Well, now the Star has revealed that the PPC is Texas Gov.
This can be restated in terms of V / P, or pieces per capita (ppc), as:
To construct the GST-fusion protein expression vectors, the BTBD inserts from the prey vector pPC86 were amplified using primers complementary to the BTBD coding regions with additional Sma I and EcoR I restriction sites for insertion into these sites in pGEX-2TK (Pharmacia).
A few weeks ago, the Drudge Report published an unsourced item claiming that an unnamed potential presidential candidate was worried that a picture of this youthful PPC dancing nude on a bar was out there somewhere.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).