Example sentences for: pfa

How can you use “pfa” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • $20,171 to support overtime costs of two additional officers to serve PFAs during nonscheduled work hours, ensuring more expedient and immediate delivery and service of PFA orders.

  • After incubation for 20 min at 4°, the cells were centrifuged, decanted and resuspended in 4% PFA for 30 min at 4°.

  • prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).

  • We have performed ultrastructural analysis by SEM of cells fixed and/or extracted by the methods listed in Table 1. When the cells were treated with coagulant fixatives, the cytoskeleton was apparently exposed, but the three dimensional structures at the edge of the cells were not preserved as well as those prepared by the DOTMAC/PFA method (data not shown).

  • The DOTMAC/PFA method provided excellent morphological preservation and immunolabeling with high fluorescence intensity of actin stress fibers and microextensions (Figure 3Qand 3S).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast