Words similar to pfa

Example sentences for: pfa

How can you use “pfa” in a sentence? Here are some example sentences to help you improve your vocabulary:

West said she feels a custody order should be allowed to stand for the full term of the PFA - up to 18 months - as it does in many other counties in the state.
However, no morphological difference between PFA and formaldehyde was apparent when cells were extracted with DOTMAC (data not shown).
Figure 5demonstrates another example of NIH3T3 cells stained with actin monoclonal and moesin polyclonal antibodies after DOTMAC/PFA fixation.
prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).
Sarah T. Casey, executive director of Schuylkill Women in Crisis, finds it disturbing that in most cases, the fine for violating a PFA is little more than the fine someone would get for cruelty and abuse toward an animal.