Words similar to pfa

Example sentences for: pfa

How can you use “pfa” in a sentence? Here are some example sentences to help you improve your vocabulary:

Figure 5demonstrates another example of NIH3T3 cells stained with actin monoclonal and moesin polyclonal antibodies after DOTMAC/PFA fixation.
Sarah T. Casey, executive director of Schuylkill Women in Crisis, finds it disturbing that in most cases, the fine for violating a PFA is little more than the fine someone would get for cruelty and abuse toward an animal.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
1PIPs, polyphosphoinositides; DOTMAC, dodecyltrimethylammonium chloride; FA, formaldehyde; PFA, paraformaldehyde; SEM, scanning EM; TEM, transmission EM.
After cell surface staining, the cells were fixed with 2% paraformaldehyde (PFA)/PBS at 4°C overnight.