Example sentences for: pfa

How can you use “pfa” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Moesin staining, on the other hand, was primarily at the edge of cells and in microextensions, when cells were fixed with TCA or DOTMAC/PFA (Figure 4Gand 4K).

  • She finds fault with the local requirement that a custody order must be established within 30 days after a PFA is filed.

  • Cells on glass coverslips were rinsed with PBS(+), fixed and/or extracted by one of the procedures listed in Table 1. Methanol-free formaldehyde solution can be obtained from commercial sources, but it has to be used within a week and is more expensive than PFA powder [ 61].

  • 2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of

  • Sarah T. Casey, executive director of Schuylkill Women in Crisis, finds it disturbing that in most cases, the fine for violating a PFA is little more than the fine someone would get for cruelty and abuse toward an animal.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast