Words similar to orf
Example sentences for: orf
How can you use “orf” in a sentence? Here are some example sentences to help you improve your vocabulary:
2 plasmid contains an oriE for plasmid replication in E. coli , the mycobacteriophage L5 integrase and attP site to allow integration into the M. smegmatis chromosome, two selectable genes, ble (bleomycin or zeocin resistance) and amp (ampicillin resistance), and the M. tuberculosis RV1221 ORF cloned downstream of the M. tuberculosis hsp60 promoter.
The CG14975 ORF probe was generated using primers CG14975FWD (TCAGCCGAGAGATTCTAGAGAG) and CG14975REV (CATCGACCATTGTTCTCTCTCC).
On many occasions, the Bro-N and KilA-N domains are fused to the same carboxy-terminal domains (Table 1, Figure 2), such as the Bro-C, T5ORF172, KilA-C, and Mx8P63-C domains.
For each gene, transcript length obtained using Northern blot is consistent with the cDNA length plus a poly(A) tail, assuming the putative promoter (positions 1133-1094 for ORF1L and 944-983 for ORF2S) and potential polyadenylation signal sequence are utilized.
In all other cases, the largest predicted ORF was selected.
Loading...