Words similar to oligodeoxynucleotide

Example sentences for: oligodeoxynucleotide

How can you use “oligodeoxynucleotide” in a sentence? Here are some example sentences to help you improve your vocabulary:

The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
Various pairs of oligodeoxynucleotide primers were designed on the basis of the PlasmoDB-predicted mRNA sequence (Gene chr14_1.phat_133), and employed in reverse transcription-PCR (RT-PCR) amplification using Pf3D7 total mRNA as template.
For these experiments we used phosphothioated antisense oligodeoxynucleotide (ODN), synthesized and HPLC purified by Sigma Genosys, to block the TN production.