Words similar to oligodeoxynucleotide
Example sentences for: oligodeoxynucleotide
How can you use “oligodeoxynucleotide” in a sentence? Here are some example sentences to help you improve your vocabulary:
Various pairs of oligodeoxynucleotide primers were designed on the basis of the PlasmoDB-predicted mRNA sequence (Gene chr14_1.phat_133), and employed in reverse transcription-PCR (RT-PCR) amplification using Pf3D7 total mRNA as template.
For these experiments we used phosphothioated antisense oligodeoxynucleotide (ODN), synthesized and HPLC purified by Sigma Genosys, to block the TN production.
The following oligodeoxynucleotide primers were designed against the putative PfPP5 sequence found on chromosome 13 (AL049185; Plasmodium falciparum chr13_002073): ATGTTACACAACCATGATGTAGAAGAAG;TAAATGTTTTGATACAAATTATGAGC.
Loading...