Words similar to lysyl

Example sentences for: lysyl

How can you use “lysyl” in a sentence? Here are some example sentences to help you improve your vocabulary:

To address whether plasmid pM1 indeed increased lysyl tRNA synthetase activity, lysates from pRS423 and pM1-transformed BY71-6c were assayed for incorporation of 3H lysine into yeast tRNA.
However, deletion of lysU had no effect on heat-shock inducible AppppA accumulation [ 37 ] . The KRS1 gene [ 38 ] encoding cytosolic lysyl tRNA synthetase was cloned into multicopy plasmid pRS423 [ 39 ] to generate plasmid pM1.
To determine whether a multicopy lysyl tRNA synthetase plasmid affected accumulation of dinucleoside polyphosphates, we transformed HNT2 ADE2 strain BY71-16d and hnt2ΔADE2 strain BY71-6c with control plasmid pRS423 and with plasmid pM1.
Dinucleoside polyphosphate levels may not be limited by the levels of lysyl tRNA synthetase
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).