Words similar to lysyl

Example sentences for: lysyl

How can you use “lysyl” in a sentence? Here are some example sentences to help you improve your vocabulary:

To address whether plasmid pM1 indeed increased lysyl tRNA synthetase activity, lysates from pRS423 and pM1-transformed BY71-6c were assayed for incorporation of 3H lysine into yeast tRNA.
Additionally, to test whether moderate overexpression of the lysyl tRNA synthetase gene affected accumulation, we compared control transformants to multicopy KRS1 transformants of the two strains.
To determine whether a multicopy lysyl tRNA synthetase plasmid affected accumulation of dinucleoside polyphosphates, we transformed HNT2 ADE2 strain BY71-16d and hnt2ΔADE2 strain BY71-6c with control plasmid pRS423 and with plasmid pM1.
Further iterations of the search using each of the detected proteins as a new query resulted in the detection of several more eukaryotic proteins, including EGL-9 and leprecan, several uncharacterized bacterial proteins and prolyl and lysyl hydroxylases.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).