Words similar to lysyl

Example sentences for: lysyl

How can you use “lysyl” in a sentence? Here are some example sentences to help you improve your vocabulary:

The conservation of all the residues implicated in catalysis in the biochemically uncharacterized proteins such as AlkB, EGL-9, leprecan and YbiX suggests they all catalyze oxidative reactions similar to those catalyzed by IPNS, DAOCS, CAS and related enzymes such as protein lysyl/prolyl hydroxylases, EFE and leucoanthocyanidin oxidases [ 1, 2].
Dinucleoside polyphosphate levels may not be limited by the levels of lysyl tRNA synthetase
To address whether plasmid pM1 indeed increased lysyl tRNA synthetase activity, lysates from pRS423 and pM1-transformed BY71-6c were assayed for incorporation of 3H lysine into yeast tRNA.
AppppA is induced by heat shock in bacteria [ 36 ] and the induction of AppppA was thought to be a function of the heat-shock inducible LysU lysyl tRNA synthetase.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).