Words similar to lysyl

Example sentences for: lysyl

How can you use “lysyl” in a sentence? Here are some example sentences to help you improve your vocabulary:

The conservation of all the residues implicated in catalysis in the biochemically uncharacterized proteins such as AlkB, EGL-9, leprecan and YbiX suggests they all catalyze oxidative reactions similar to those catalyzed by IPNS, DAOCS, CAS and related enzymes such as protein lysyl/prolyl hydroxylases, EFE and leucoanthocyanidin oxidases [ 1, 2].
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).
However, deletion of lysU had no effect on heat-shock inducible AppppA accumulation [ 37 ] . The KRS1 gene [ 38 ] encoding cytosolic lysyl tRNA synthetase was cloned into multicopy plasmid pRS423 [ 39 ] to generate plasmid pM1.
Further iterations of the search using each of the detected proteins as a new query resulted in the detection of several more eukaryotic proteins, including EGL-9 and leprecan, several uncharacterized bacterial proteins and prolyl and lysyl hydroxylases.
AppppA is induced by heat shock in bacteria [ 36 ] and the induction of AppppA was thought to be a function of the heat-shock inducible LysU lysyl tRNA synthetase.