Words similar to kb

Example sentences for: kb

How can you use “kb” in a sentence? Here are some example sentences to help you improve your vocabulary:

Direct sequencing of PCR amplified genomic fragments was performed as described previously [ 11 ] . The 5' flanking region, all the exons and the 3'UTR region, as well as the introns of Abcg5 and Abcg8 with size less than 1 Kb, were individually amplified using primers, as described in Table 2. The amplified PCR products were sequenced by the use of an automated capillary sequencer.
For example, we used information about the position of genes and considered only the first hit upstream of the translation start codon of each gene, but less than 5 kb upstream of the annotated 5' UTR end.
A broader range of sequences, including mitochondrial and large viral genomes, has been surveyed by Karlin et al [ 3 4 6 8 9 12 17 ] using 50 kb and larger windows.
1 kb) CF: CGGTTCTTTTTGTCAAGAC/ATCCTCGCCGTCGGGCATGC (400 bp).
Clones 3 to 4.5 kb in size, were sequenced using a minimal path of transposon-bearing clones.