Words similar to hind
Example sentences for: hind
How can you use “hind” in a sentence? Here are some example sentences to help you improve your vocabulary:
The copy numbers of insertions in these lines were estimated with restriction digests of genomic DNA using Bgl II and Hind III in addition to Pst I, followed by Southern blot analysis using the LacI/NLS fragment as a probe (Figures 1, 2).
Final BAC assemblies were then verified by comparing the virtual restriction digest to Eco RI, Bam HI and Hind III fingerprints produced by HGSC and manually called at LBNL and HGSC.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
After confirmation of the sequence, the mutated pL1PUC19 plasmid was digested with Nde I and Hind III, and the 900 bp, mutated L1 gene was gel purified and ligated into pET26b to create the mutant overexpression plasmids.
Probes were quantitated by fractionation of 1/10 thvolume in a 0.8% agarose gel compared to a known quantity of Hind III digested lambda DNA.