Words similar to hind
Example sentences for: hind
How can you use “hind” in a sentence? Here are some example sentences to help you improve your vocabulary:
Although such reports of increased vessel growth and functional improvement in response to exogenously administered angiogenic factors are encouraging, it is essential to note that animal models such as the ischemic hind limb model have definite limitations.
In contrast, periarticular injection of Ad-mIL-4 was able to reverse pathology in established disease not only in the treated hind paws, but also in the untreated front paws.
Naked plasmid DNA injected directly into the skeletal muscle in a later study, using the same hind limb ischemia model, also yielded increased collateral vessels, as determined by angiography and improved perfusion [ 7].
It has been reported that CEP cells are able to participate in new vessel growth in a variety of animal models, including the rabbit ischemic hind limb model [ 59].
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.