Words similar to hind

Example sentences for: hind

How can you use “hind” in a sentence? Here are some example sentences to help you improve your vocabulary:

, 1985) was cut with Hind III and Aat II and the 2170 bp fragment containing the β-lactamase gene and the ColE1 replication origin was isolated, and two different synthetic double stranded oligonucleotides were inserted (order of restriction sites Hind III-Asc I-EcoR I-Xho I-Sfi I/Bgl I-T7promoter-Aat II).
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
RNase protection assays were performed as described previously [ 22 ] . A Hind III fragment of the rabbit EP 2 receptor located in the the 3' untranslated region (3'UTR) was subcloned into pBluescript SK(-) plasmid (Stratagene).
Popeye reared up and plopped on her back and there was a sudden grunting and whinnying and with both hind legs Canada Miss bucked and threw Popeye off her back.
Primary cultures were prepared from hind limbs of day 18 embryos (E18) as described previously [ 45].