Example sentences for: hind

How can you use “hind” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.

  • In one early study using recombinant protein, a single intra-arterial injection of 500-1000 μg VEGF165 into rabbits with severe experimental hind limb ischemia increased collateral vessels, as detected by angiography and histological analysis [ 6].

  • To screen for the presence of the mutation, the alpha-2 adrenergic receptor insert was cut from the vector using Hind III (895) and EcoR1 (1841) and cut with Ddel.

  • After confirmation of the sequence, the mutated pL1PUC19 plasmid was digested with Nde I and Hind III, and the 900 bp, mutated L1 gene was gel purified and ligated into pET26b to create the mutant overexpression plasmids.

  • 1. 2) The hygromycin B-resistance gene ( hyg ) was recovered from pUS267 by Hind III digestion and cloned into the Hind III site of pSE.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast