Words similar to gad

Example sentences for: gad

How can you use “gad” in a sentence? Here are some example sentences to help you improve your vocabulary:

0. It was surprising that this very early phase of Gad1 expression was largely outside of the developing CNS and was localized in the tail bud mesenchyme and in the pre-apical ectodermal ridge (pre-AER) of the forelimb bud.
A notable feature of this expression pattern is that Gad1 transcripts accumulate in the specialized ectodermal structures that are involved in the formation of the mystacial vibrissae and in limb outgrowth.
However, both GAD65 and GAD67 mRNA can be detected in the thymic medullary epithelial cells in mice [ 24 ] . Thus, despite thymic expression of GAD65 and GAD67 at the level of mRNA, NOD mice spontaneously develop autoreactivity to these islet (and brain) expressed proteins, and re-challenge of mice that have been immunized with peptides from GAD65 results in severe anaphylactic reactions.
As development proceeded Gad1 was detected in pharyngeal endoderm and in the ectodermal placodes of the vibrissae.
Potential true positive clones were sequenced using primers GAD10SEQ 5'TACCACTACAATGGATG and GAD10cSEQ 5'GTTGAAGTGAACTTGCGGGG with the automated DNA sequencing facilities available at our Institution.