Words similar to fok

Example sentences for: fok

How can you use “fok” in a sentence? Here are some example sentences to help you improve your vocabulary:

The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.
To examine the influence of the available covariates in addition to the Fok I polymorphism on beta cell function and insulin sensitivity, we employed a stepwise regression analytical approach.
We found that the Fok I polymorphism is associated with insulin resistance in a Caucasian population.
Fok I digested the first ATG and yielded two products, 69 and 196 base pairs (f allele), while the T to C transition destroyed the Fok I site (F allele).
Then, 5 μl of the PCR product (265 base pairs) was digested in 15-μl of reaction volume containing 1 U of Fok I (New England Biolabs Inc., Beverly, Massachusetts, USA) with the buffer supplied by the vender.