Words similar to fok

Example sentences for: fok

How can you use “fok” in a sentence? Here are some example sentences to help you improve your vocabulary:

DNA extraction and genotyping of the Fok I polymorphism
Then, 5 μl of the PCR product (265 base pairs) was digested in 15-μl of reaction volume containing 1 U of Fok I (New England Biolabs Inc., Beverly, Massachusetts, USA) with the buffer supplied by the vender.
In the present study, we also found that the Fok I polymorphism was associated with obesity assessed by waist-hip ratio but not by body mass index (Table 1).
The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.
Fok I digested the first ATG and yielded two products, 69 and 196 base pairs (f allele), while the T to C transition destroyed the Fok I site (F allele).