Words similar to ecori

Example sentences for: ecori

How can you use “ecori” in a sentence? Here are some example sentences to help you improve your vocabulary:

The plasmid pLacZ contains the LacZ coding region from pSVβgal subcloned into the HindIII / EcoRI site of pUC19.
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The GAL4-β box fusion was prepared by synthesizing oligonucleotides corresponding to the β-box sequence with engineered EcoRI and SalI restriction sites.
pGST-p20-C/EBPβ was constructed by inserting the 581 bp BamHI/EcoRI fragment from pRsetA-LIP [ 34] into similarly digested pGEX4T-1.
The EcoRI site is at the 5' end of clone CH211-251J8.