Words similar to ecori
Example sentences for: ecori
How can you use “ecori” in a sentence? Here are some example sentences to help you improve your vocabulary:
The forward primer, 5'ACTGACGAATTCAGCCACCATGGCGCTCCTGCTGTGC3' introduced an EcoRI site and the reverse primer, 5'GTCAGTCCCGGGTCAGTCAGCTACTTTTTACGACAGCAAAAGAT3' introduced stop codons in three reading frames and a SmaI site.
Btk:ER constructs were subcloned from pBP3:Btk:ER into the EcoRI site of the pApuroII vector.
To construct the cTOP1 expression vector (pDBleu-TOP1c), cTOP1 was excised from pGBD-cTOP1 with EcoRI and BamHI and inserted into the same sites in pDBleu (ProQuest, Life Technologies).
The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.
The orientation of gene in the resulting plasmid pBS58 ftsZ mut was examined by EcoRI digestion.
Loading...