Example sentences for: ecor

How can you use “ecor” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • pVL-GST-NFATp was created by subcloning a Nde I - EcoR I fragment containing the NFATp cDNA from pBS-KS +-NFATp(NdeI) into the Nde I and EcoR I sites of pVL1392-GST (gift of S. Ruppert and R. Tjian).

  • A second 2.6 kb EcoR I/ BamH I fragment 3' of exon 4 of the γ 1 gene was cloned into a site between the neo and TK genes (Fig.

  • EcoR I adapter was added, the cDNA was digested by Xho I and the cDNA was inserted between the EcoR I and Xho I sites of the vectors in a directional fashion.

  • GAL1 promoter, a PPT1 DNA fragment was cut from pET-GST-PPT1 by EcoR I and Not I digestion and subcloned into the EcoR I/ Not I-digested YCpIF16 (ATCC No.

  • To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast