Words similar to ecor

Example sentences for: ecor

How can you use “ecor” in a sentence? Here are some example sentences to help you improve your vocabulary:

CD4 [ 36 ] and CD8 [ 37 ] were kind gifts from Dr. Dan Littman and the respective cDNA probes were obtained by digestion with the EcoR 1 restriction endonuclease.
A plasmid was constructed that carried 825 bp from the pseudokinase domain of ifkA and 731 bp from the kinase domain, placed at either end of a 1.4 kb blasticidin resistance cassette [ 48 ] . A 3.95 kb EcoR I/ Hind III fragment, containing the ifkA sequences and the blasticidin gene, was released from the plasmid and it's ends were made blunt using the klenow fragment and dephosphorylated to prevent recircularization and reduce nonspecific integration of the fragment.
After further digestion with EcoR I, the NFAT DNA fragment was isolated and ligated into the Sma I and EcoR I sites of pVL1393HAX.
To screen for the presence of the mutation, the alpha-2 adrenergic receptor insert was cut from the vector using Hind III (895) and EcoR1 (1841) and cut with Ddel.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.