Words similar to dmsa

Example sentences for: dmsa

How can you use “dmsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

Furthermore, the NarL footprint pattern does not extend into the dmsA P2 promoter region.
The protections are consistent with the proposal that NarL-phosphate recognizes and binds at multiple heptamer recognition sites within the dmsA P1 promoter region.
These findings demonstrate that the smaller dmsA region containing only one of the three consensus heptamer sites (Figure 4) is sufficient for NarL binding.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).
The hydroxyl radical protected regions for the dmsA strands of DNA were offset by 3 bp in the 3' direction (Figure 4).