Words similar to dmsa

Example sentences for: dmsa

How can you use “dmsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

The location of the NarL-phosphate protected regions within a 97 bp segment of the dmsA promoter is consistent with the model for dmsABC expression whereby multiple molecules of NarL-phosphate recognize and bind to the DNA in a weak and cooperative fashion.
As the three consensus NarL boxes flank the dmsA promoter and are spaced 20 bp apart (Figure 4), the spacing and orientation of the NarL protected regions make it tempting to speculate that NarL-phosphate binds at each site.
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).
This is noteworthy since a 7-2-7 sequence has been speculated for nucleating NarL interactions at other promoters [ 31 ] . Stoichiometry experiments are planned to ascertain the number of NarL molecules that bind the dmsA promoter region, as are studies to mutagenize one or more of the NarL binding sites to determine the importance of the NarL consensus binding sites at the dmsA promoter.
To investigate the effects of sequence changes in the dmsA Fnr-recognition site on the anaerobic activation of dmsA-lacZ expression, site-directed mutagenesis and β-galactosidase assays were performed (Figure 1).