Words similar to dmsa

Example sentences for: dmsa

How can you use “dmsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).
The DNase I footprint of the non-coding strand of dmsA with phosphorylated NarL revealed an 83 bp protected region that extends from -51 to +32 relative to the start of transcription (Figure 3).
To introduce mutations within or nearby the proposed Fnr recognition site at the dmsA promoter, site-directed mutagenesis was performed using the method of Kunkel [ 33 ] . The template for mutagenesis was m13mp19-100 which contained a 676 bp Bam HI fragment containing 587 bp of DNA upstream of the dmsA translational start site and the associated 89 bp of the dmsA coding region.
To our knowledge, this "consensus" Fnr-dependent dmsA promoter exhibits the highest anaerobic induction of any Fnr-regulated E. coli promoter examined.
In addition, β-galactosidase assays revealed that the 10-fold nitrate dependent repression of dmsA-lacZ expression was unaffected by the deletion of upstream DNA sequence to -71 relative to the start of dmsA transcription, further pinpointing the location of the 5' end of the NarL recognition site for dmsA (data not shown).