Words similar to dmsa

Example sentences for: dmsa

How can you use “dmsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

The fragment extends from position -127 to -13 relative to the start of dmsA transcription at P1 (Figure 4).
A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).
To introduce mutations within or nearby the proposed Fnr recognition site at the dmsA promoter, site-directed mutagenesis was performed using the method of Kunkel [ 33 ] . The template for mutagenesis was m13mp19-100 which contained a 676 bp Bam HI fragment containing 587 bp of DNA upstream of the dmsA translational start site and the associated 89 bp of the dmsA coding region.
Furthermore, nonphosphorylated NarL was unable to protect the NarL binding sequences at the dmsA promoter region, suggesting that phosphorylation of NarL is required for repression of dmsABC expression.
, TTGAT to TT AG T) of the native dmsA sequence, it nearly abolished the anaerobic induction of dmsA-lacZ expression (Figure 1, λJA257).