Words similar to derived

Example sentences for: derived

How can you use “derived” in a sentence? Here are some example sentences to help you improve your vocabulary:

For both Sm and RNP, specific quantitative values for each specimen were obtained by extrapolation of optical densities (OD) from a standard curve derived from six points.
For example, it has been shown that synaptosomes and mitochondria prepared from CNS tissue can convert cholesterol to cholesterol oxides, which may play an important role in brain tissue damage during oxidative stress [ 28 ] . Consistent with this notion, we have shown cholesterol oxides are toxic to neuronal PC12 cells [ 29 30 ] and neurons derived from sympathetic ganglia [ 31 ] , retina [ 32 ] and cerebellum [ 33 ] .
Studies on a variety of preparations indicate that most of the choline used for ACh synthesis is derived from the extracellular space (reviewed in [ 1 ] ) and therefore the PLD pathway has to be considered as an accessory process.
Whereas a great deal of genetic variability exists among different tumors from different patients, lesser genetic heterogeneity would be expected in xenografts of cancer cells originally derived from a single patient.
DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.