Words similar to deletion

Example sentences for: deletion

How can you use “deletion” in a sentence? Here are some example sentences to help you improve your vocabulary:

To test the role of TPR region in this activation, a TPR deletion mutant of PP5 (ΔTPR-PfPP5) starting at the Met-273 was expressed with an N-terminal (His) 6 tag.
The following primers were used to generate the deletion (del) L747–E749;A750P mutant: forward 5′- TAAAATTCCCGTCGCTATCAAGGAGCCAACATCTCCGAAAGCCAACAAGG-3′ and reverse 5′- CCTTGTTGGCTTTCGGAGATGTTGGCTCCTTGATAGCGACGGGAATTTTA-3′.
She is a member of the kindred initially described by Graber et al [ 1 ] . We screened this individual for mutations and found a novel mutation in exon 5 of LMNA . This two bp deletion is predicted to disrupt the reading frame and produce a truncated lamin A and C.
The ~2 kb deletion of vector DNA in the sur2 clone results in a fusion of the ORF of the L5 integrase with that of the M. tuberculosis insert such that the fused ORF encodes a protein that contains only the amino-terminal 73 aa of the 344 aa L5 integrase.
This observation was confirmed by overexpressing GFP-tagged Pop1p or Pop2p in pop1 pop2 double deletion mutants (data not shown).