Words similar to ctt
- ca
- caa
- caaaagggagaagtctaacttc-
- caaatcaaat
- cab
- cseq
- csnps
- cstat
- ctal
- ctims, d
- cting
- ctivated
- ctn
- ctnagn
- ctngaannttcna
- ctop
- ctp
- ctr
- ctrl
- ctt
- cttcagttttgcgtcttatttc
- cttcccaggacttttctcca-
- cttccgagagtctctgtggc-
- cttcctcctcgggcgggtgt
- cttcctggaggtcacggctcaagg-
- cttgcaggagaactttccagaa-
- ctual
- ctually
- cu
- cualquier
Example sentences for: ctt
How can you use “ctt” in a sentence? Here are some example sentences to help you improve your vocabulary:
- CTT : Central tegmental tract
*The views expressed in this paper are those of the authors and do not necessarilyrepresent the opinions of CTT - Correios de Portugal, Poste Italiane or the Postal RateCommission.
The Ymut2 site, which is the most important site for controlling basal expression, overlaps a potential initiator site fitting the consensus (5' CTT CCC TTT TCC 3') for the ribosomal protein Inr family with only one mismatched base [ 40].
A zinc-responsive element (ZRE) consensus DNA sequence, ACCYTNARGGT (in the single-letter amino-acid code, where N is any nucleotide, Y is C or T, and R is A or G) (compare Figure 2of [ 13]), is located in close proximity to CTT1 (chromosome VII, location 65270-80), MNT2 (VII, 20659-69 and 20774-84), YOL083w (XI, 442975-85) and YNL253w (XIV, 169669).
Point mutations were introduced into Rlk-GFP by a PCR based strategy [ 53] with oligonucleotides encoding the required mutations (Mutated residues are in bold): Y420F (GGAC GAT GAA T TC ATC AGT TCT TCT G), Y91F (GTC AAG GCT CTT T T T GAC TTC CTG CC).
Loading...