Words similar to ctt
- ca
- caa
- caaaagggagaagtctaacttc-
- caaatcaaat
- cab
- cseq
- csnps
- cstat
- ctal
- ctims, d
- cting
- ctivated
- ctn
- ctnagn
- ctngaannttcna
- ctop
- ctp
- ctr
- ctrl
- ctt
- cttcagttttgcgtcttatttc
- cttcccaggacttttctcca-
- cttccgagagtctctgtggc-
- cttcctcctcgggcgggtgt
- cttcctggaggtcacggctcaagg-
- cttgcaggagaactttccagaa-
- ctual
- ctually
- cu
- cualquier
Example sentences for: ctt
How can you use “ctt” in a sentence? Here are some example sentences to help you improve your vocabulary:
*The views expressed in this paper are those of the authors and do not necessarilyrepresent the opinions of CTT - Correios de Portugal, Poste Italiane or the Postal RateCommission.
CTT - Correios de Portugal
The double stranded oligos used were as follows: for the Ets binding site on the CD5 promoter, 5' CGC GTA CAG GGA GGA AGT TGA CCT CGA 3'; for the oligonucleotides containing the CD5X region, 5' AGG CCT AAG TTG ACA GTT CAA CTT CAA ACA CTC GAG 3'; and for the CD5Y oligo, 5' AGG CCT CAC AGG CCC ACA CTG CCT GCT TCC CTG GAG 3'.
A cDNA that encodes a hemagglutinin-tagged NPM3 protein was produced by PCR under the following conditions: 100 μl reactions with 1X Pfu buffer, 0.2 mM deoxyribonucleotides, 1 μM HA-F primer (5'-AAA GAA TTC AGC ATG TAC CCA TAC GAC GTC CCA GAC TAC GCC GCC GCC GGT ACT GCA GCT GCC-3'), 1 μM NPM3 -R2 primer (5'-AAA GAA TTC CTA GGG CCT GCC CCC CTG CTT TTT GGC AGG AAG GAT GGG-3'), 1 ng of human NPM3 cDNA insert, and 2.5 Units of recombinant Pfu DNA Polymerase.
The AtMAF1 open reading frame was isolated by PCR from Arabidopis genomic DNA using the 5' primer 5'-TCC ATG GCC GAA ACC GAA-3' and the 3' primer 5'-CTA AGT TCA CTT CGA ACT GCT C-3', which had been designed to match the Arabidopsis MAF1 homolog on the P1 clone MGG4 of chromosome 5 (GenBank accession number AB008267).
Loading...