Words similar to ctt
- ca
- caa
- caaaagggagaagtctaacttc-
- caaatcaaat
- cab
- cseq
- csnps
- cstat
- ctal
- ctims, d
- cting
- ctivated
- ctn
- ctnagn
- ctngaannttcna
- ctop
- ctp
- ctr
- ctrl
- ctt
- cttcagttttgcgtcttatttc
- cttcccaggacttttctcca-
- cttccgagagtctctgtggc-
- cttcctcctcgggcgggtgt
- cttcctggaggtcacggctcaagg-
- cttgcaggagaactttccagaa-
- ctual
- ctually
- cu
- cualquier
Example sentences for: ctt
How can you use “ctt” in a sentence? Here are some example sentences to help you improve your vocabulary:
CTT1 and YOL083w are like the two genes PHM7 and YGL121c discussed by [ 13], in that having the zap1 :: TRP1 genotype does not entirely eliminate transcriptional response to zinc deficiency.
80: C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C (regions 2241-2244, 2266-2268, 2272-2274 are randomized, silent mutations are in lower case)
QUASI performs this procedure for all replacement point mutations [ e.g. , in the example case, Tyr (tat), Ile (att), Leu (tta, ttg, and ctt), Val (gtt), Ser (tct), and Cys (tgt)].
The primers for rat constitutively expressed ribosomal S12, were sense:5'-ACG TCA ACA CTG CTC TAC A-3' and antisense:5'-CTT TGC CAT AGT CCT TAA C-3' and generate a 303 bp cDNA product as previously described [ 63 ] . Controls for RT-PCR included samples without the enzyme reverse transcriptase and samples without template.
Point mutations were introduced into Rlk-GFP by a PCR based strategy [ 53] with oligonucleotides encoding the required mutations (Mutated residues are in bold): Y420F (GGAC GAT GAA T TC ATC AGT TCT TCT G), Y91F (GTC AAG GCT CTT T T T GAC TTC CTG CC).