Words similar to ctt
- ca
- caa
- caaaagggagaagtctaacttc-
- caaatcaaat
- cab
- cseq
- csnps
- cstat
- ctal
- ctims, d
- cting
- ctivated
- ctn
- ctnagn
- ctngaannttcna
- ctop
- ctp
- ctr
- ctrl
- ctt
- cttcagttttgcgtcttatttc
- cttcccaggacttttctcca-
- cttccgagagtctctgtggc-
- cttcctcctcgggcgggtgt
- cttcctggaggtcacggctcaagg-
- cttgcaggagaactttccagaa-
- ctual
- ctually
- cu
- cualquier
Example sentences for: ctt
How can you use “ctt” in a sentence? Here are some example sentences to help you improve your vocabulary:
The primers for rat constitutively expressed ribosomal S12, were sense:5'-ACG TCA ACA CTG CTC TAC A-3' and antisense:5'-CTT TGC CAT AGT CCT TAA C-3' and generate a 303 bp cDNA product as previously described [ 63 ] . Controls for RT-PCR included samples without the enzyme reverse transcriptase and samples without template.
The authors supplied the data for CTT Correios de Portugal and Poste Italiane.
QUASI performs this procedure for all replacement point mutations [ e.g. , in the example case, Tyr (tat), Ile (att), Leu (tta, ttg, and ctt), Val (gtt), Ser (tct), and Cys (tgt)].
80: C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C (regions 2241-2244, 2266-2268, 2272-2274 are randomized, silent mutations are in lower case)
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.