Words similar to cttcctcctcgggcgggtgt

Example sentences for: cttcctcctcgggcgggtgt

How can you use “cttcctcctcgggcgggtgt” in a sentence? Here are some example sentences to help you improve your vocabulary:

PCR was done to amplify the resultant cDNAs using the GeneRacer 5' primer and a primer consisting of bases immediately upstream of the translation start site of the p27 Kip1gene (CTTTCTCCCGGGTCTGCACGACCG for human and CTTCCTCCTCGGGCGGGTGT for mouse).