Words similar to ctttctcccgggtctgcacgaccg
Example sentences for: ctttctcccgggtctgcacgaccg
How can you use “ctttctcccgggtctgcacgaccg” in a sentence? Here are some example sentences to help you improve your vocabulary:
PCR was done to amplify the resultant cDNAs using the GeneRacer 5' primer and a primer consisting of bases immediately upstream of the translation start site of the p27 Kip1gene (CTTTCTCCCGGGTCTGCACGACCG for human and CTTCCTCCTCGGGCGGGTGT for mouse).
Loading...