Example sentences for: cseq
How can you use “cseq” in a sentence? Here are some example sentences to help you improve your vocabulary:
The constructs were sequenced as described above using primers pGAD10SEQ and pGAD10cSEQ.
The construct was sequenced as described above using the primers pGAD10SEQ and pGAD10cSEQ.
Potential true positive clones were sequenced using primers GAD10SEQ 5'TACCACTACAATGGATG and GAD10cSEQ 5'GTTGAAGTGAACTTGCGGGG with the automated DNA sequencing facilities available at our Institution.
Loading...