Example sentences for: cf

How can you use “cf” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • These are linguistic clues, and can be misleading: cf.

  • 6b, cf.

  • Strain 144M, a serum-sensitive mucoid isolate from a CF patient, contains short O-side chain LPS, while its serum-resistant derivative, 144M(SR), which is also mucoid, has long O-side chain LPS [ 33 ] . Strain FRD-1 is a mucoid CF isolate [ 34 ] and FRD-2 is its spontaneous nonmucoid derivative [ 35 ] . P. aeruginosa ATCC strains 10145 and 9027 are nonmucoid strains with long O-side chain LPSs [N L Schiller, unpublished results].

  • 1 kb) CF: CGGTTCTTTTTGTCAAGAC/ATCCTCGCCGTCGGGCATGC (400 bp).

  • Genomovars II and V have also been recovered from CF patients [ 18 ] . Of critical concern are B. cepacia 's transmissibility from one patient to another and its propensity to give rise to the B. cepacia syndrome, which results in a rapid decline in pulmonary function [ 2 18 ] . The ability of B. cepacia as well as P. aeruginosa to cause chronic bronchopulmonary infections in CF patients is exacerbated by their intrinsic or acquired resistance to many conventional antibiotics.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast