Words similar to cf

Example sentences for: cf

How can you use “cf” in a sentence? Here are some example sentences to help you improve your vocabulary:

These are linguistic clues, and can be misleading: cf.
6b, cf.
Strain 144M, a serum-sensitive mucoid isolate from a CF patient, contains short O-side chain LPS, while its serum-resistant derivative, 144M(SR), which is also mucoid, has long O-side chain LPS [ 33 ] . Strain FRD-1 is a mucoid CF isolate [ 34 ] and FRD-2 is its spontaneous nonmucoid derivative [ 35 ] . P. aeruginosa ATCC strains 10145 and 9027 are nonmucoid strains with long O-side chain LPSs [N L Schiller, unpublished results].
1 kb) CF: CGGTTCTTTTTGTCAAGAC/ATCCTCGCCGTCGGGCATGC (400 bp).
Genomovars II and V have also been recovered from CF patients [ 18 ] . Of critical concern are B. cepacia 's transmissibility from one patient to another and its propensity to give rise to the B. cepacia syndrome, which results in a rapid decline in pulmonary function [ 2 18 ] . The ability of B. cepacia as well as P. aeruginosa to cause chronic bronchopulmonary infections in CF patients is exacerbated by their intrinsic or acquired resistance to many conventional antibiotics.