Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
A recent immunohistochemical study has shown the presence of CCR1, CCR2 and CCR5 on CD68 +macrophages in the RA synovium, but not CCR4 [ 17 ] . Since CCL2 is a ligand for CCR2, and both CCL3 and CCL5 are ligands for both CCR1 and CCR5 [ 11 ] , these receptors are probably the CC chemokine binding sites on the macrophages in the present study.
Using cytokine/chemokine-specific primers with RT-PCR, untreated MGBE showed distinct bands representing mRNA of TNF-α, RANTES (Regulated on activation, normal T cell expressed and secreted) (CCL5), and macrophage inflammatory protein-2 (MIP-2/CXCL2) (Figure 1).
Studies performed in CD4 and CD8 knockout mice also revealed a requirement for both CD4 and CD8 lymphocytes subsets for SLC/CCL21 mediated tumor regression.
Chemokine binding sites for CXCL8, but not for CCL2, CCL3 or CCL5, were found on neutrophils in the rheumatoid synovium.
This is an ADAM10-homolog known to be a tumor necrosis factor-α (TNFα) convertase [ 21 ] , TNFα produced by Kupffer cells in the liver stimulates production of TNFα, a mitogen for hepatocytes helping to generate new cells needed to rebuild damaged areas of the liver [ 22 ] . Kupffer cells have a significant role as mediators of acute inflammation after CCl 4 treatment; however, they also produce factors that can cause secondary injury in the liver through fibrogenic responses.
Loading...