Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
Genes found to be associated with the biology of CCl 4 toxicity are highlighted.
A recent immunohistochemical study has shown the presence of CCR1, CCR2 and CCR5 on CD68 +macrophages in the RA synovium, but not CCR4 [ 17 ] . Since CCL2 is a ligand for CCR2, and both CCL3 and CCL5 are ligands for both CCR1 and CCR5 [ 11 ] , these receptors are probably the CC chemokine binding sites on the macrophages in the present study.
Chemokine binding sites for CXCL8, but not for CCL2, CCL3 or CCL5, were found on neutrophils in the rheumatoid synovium.
After treating the apical surface of the cells with LPS, the mRNA levels for TNF-α and MIP-2 (CXCL2) increased, while mRNA for IL-1β, IL-6, and MCP-1 (CCL2) appeared for the first time.
Anti-IP-10/CXCL10, MIG/CXCL9 and IFNγ antibodies each partially but yet significantly inhibited the anti-tumor efficacy of SLC/CCL21 (Figure 1* p < 0.01 compared to the control antibody group).
Loading...