Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
Neutrophils did not show any signal for binding CCL2, CCL3 and CCL5 (Fig.
The second principal component of the gene-expression data separated the day-4-treated animals from all others, including the remaining CCl 4 -treated days 7 and 14 (Figure 3a).
The role of VEGF in the recovery of necrotic liver following CCl 4 treatment has been well established [ 23 24 ] . Here, several VEGF isoforms were found to correlate with clear-space-related metrics.
The experiments showed that unstimulated MGBE express mRNA for TNF-α, MIP-2, and RANTES (CCL5).
A suppression of AdoMet synthetase activity has been observed in a model of acetaminophen toxicity [ 20 ] . The negative correlation of AdoMet synthetase mRNA observed in the present study suggests that CCl 4 toxicity suppresses message as well, as AdoMet synthetase was most significantly correlated with % clear space.
Loading...