Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
This novel method was evaluated on an established, extreme model of liver toxicity using carbon tetrachloride (CCl 4 ) in rats that were dosed for 3 days and allowed to recover.
Here we show that the cytokines IFNγ, IP-10/CXCL10 and MIG/CXCL9 serve as effector molecules in SLC/CCL21-mediated anti-tumor responses.
Based on these dual capacities, we as well as others have begun pre-clinical evaluation of SLC/CCL21 in several tumor models [ 9 10 25 26 27 ] .
The enterotoxin receptor, which is a marker for regeneration in both partial hepatectomy and CCl 4 toxicity [ 32 ] , was positively correlated with these tissue metrics, whereas CP1-26 was negatively correlated.
In the case of the Hint-homologous HNT1 gene of S. cerevisiae , the phenotype of the single mutant was mild and the biological pathway, positive regulation of Kin28, the yeast homolog of Cdk7, was revealed by synthetic lethal interactions between hnt1 and hypomorphic alleles of cak1 , kin28 , ccl1 and tfb3 [ 9 ] . Because backup systems to limit problems with hnt2 mutant cells apparently exist, synthetic lethal interactions may be critical to identify the Hnt2 biological pathway.
Loading...