Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
Five day established tumors were treated with intratumoral injection of 0.5 μg of recombinant murine SLC/CCL21 (Pepro Tech, Rocky Hill, NJ) or murine serum albumin (utilized as an irrelevant protein for control injections) were administered three times per week for two weeks as previously described [ 9 ] . 24 h prior to SLC/CCL21 treatment, and then three times a week, mice were injected i.p.
SLC/CCL21, a CC chemokine expressed in high endothelial venules and in T cell zones of spleen and lymph nodes, strongly attracts naive T cells and DCs [ 1 2 3 4 5 6 7 8 ] . Because DCs are potent APCs that function as principal activators of T cells, the capacity to facilitate the co-localization of both DC and T cells may reverse tumor-mediated immune suppression and orchestrate effective cell-mediated immune responses [ 9 10 25 26 27 ] . In addition to its immunotherapeutic potential, SLC/CCL21 has been found to have potent angiostatic effects [ 28 ] , thus adding further support for its use in cancer therapy.
Anti-IP-10/CXCL10, MIG/CXCL9 and IFNγ antibodies each partially but yet significantly inhibited the anti-tumor efficacy of SLC/CCL21 (Figure 1* p < 0.01 compared to the control antibody group).
We screened for the presence of Th2 cells by assessing T cell expression of CCR4—a receptor for eotaxin/CCL11, macrophage chemoattractant protein 3 (CCL7), and thymus- and activation-regulated chemokine (CCL17) [40,41]—and CCR3, a receptor for eotaxin and related chemokines.
The human FHIT gene, located at the chromosome 3 fragile site FRA3B, is inactivated early in the development of many tumors [ 1 ] . Murine Fhit is also located at a fragile site [ 2 3 ] and mice heterozygous for disruption of Fhit , given low intragastric doses of the mutagen N-nitrosomethylbenzylamine, develop stomach and sebaceous tumors [ 4 ] that can be prevented by viral Fhit expression [ 5 ] . Fhit, a dimer of 147 amino acid subunits, is a member of the histidine triad (HIT) superfamily of nucleotide hydrolases and transferases [ 6 7 ] . Members of the Hint branch of the HIT superfamily are found in all forms of life [ 8 ] . The S. cerevisiae Hint homolog, Hnt1, and rabbit Hint possess adenosine monophosphoramidase activity that functions in yeast to positively regulate function of Kin28, Ccl1 and Tfb3, which constitute the kinase component of general transcription factor TFIIH [ 9 ] . A new Hint related protein, Aprataxin, is mutated in individuals with ataxia with oculomotor apraxia [ 10 11 ] and has a yeast homolog termed Hnt3 [ 9 ] . Members of the Fhit branch of the HIT superfamily have been found in fungi [ 12 13 ] , animals [ 2 14 15 ] and plants [ 7 ] and hydrolyze diadenosine tetraphosphate, diadenosine triphosphate and other 5'-5"'-dinucleoside polyphosphates.
Loading...