Words similar to ccl
- cbs-binding
- cbs-dependent
- cbz-leu-leu-leucinal
- cc
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- ccgtcgactcactcagcaggtggcgcgca
- ccgtcgactcagagctctgcagacacaaa
- cch
- cchl
- cci
- cci-
- ccl
- ccl-
- ccls
- ccm
- ccnd
- ccny
- cco
- ccommittee
- ccr
- ccra
- ccrm
- ccs
- cct
- cctc
- ccttggatccgtagtaaaggccacgcag-
- ccttgttggctttcggagatgttggctccttgatagcgacgggaatttta-
- cctttttccaggtctgacaa-
- ccu
- ccwk
- ccy
- cd
- cd-
- cd--released
- cd-epr
Example sentences for: ccl
How can you use “ccl” in a sentence? Here are some example sentences to help you improve your vocabulary:
Representative images of tissue sections from control and treated tissues are shown in Figure 1. Examples of processed sample image tiles are shown in Figure 2, where a control liver (Figure 2a) can be compared to a treated liver (Figure 2b), illustrating the significant structural damage induced by treatment with CCl 4 . Gene-expression profiles were generated from the same livers using DNA microarrays.
While most cytokine research has focused on cells of the immune system, other cell types produce cytokines including the epithelial cells of the lung [ 28 29 ] , retina [ 30 ] , and intestines [ 31 32 ] . Among the few studies involving the biliary system, it was demonstrated that cultured human intrahepatic duct epithelial cells produce functional IL-8 and MCP-1 (CCL2) [ 14 33 ] . Isolated human intrahepatic epithelial ducts expressed immunoreactive IL-6 when treated with IL-1β or phorbal myristate acetate [ 34 ] . Intracellular TNF-α mRNA and protein was detected in intrahepatic biliary duct cells in tissue sections [ 35 ] , but not in cultured intrahepatic epithelial cells; therefore, there was no clear demonstration that biliary epithelium secretes TNF-α.
This is an ADAM10-homolog known to be a tumor necrosis factor-α (TNFα) convertase [ 21 ] , TNFα produced by Kupffer cells in the liver stimulates production of TNFα, a mitogen for hepatocytes helping to generate new cells needed to rebuild damaged areas of the liver [ 22 ] . Kupffer cells have a significant role as mediators of acute inflammation after CCl 4 treatment; however, they also produce factors that can cause secondary injury in the liver through fibrogenic responses.
Based on these dual capacities, we as well as others have begun pre-clinical evaluation of SLC/CCL21 in several tumor models [ 9 10 25 26 27 ] .
The murine fibroblast NIH 3T3 cell line (CCL 92) and the amphotropic retroviral packaging cell line PA317 (CRL 9078) were obtained from the American Type Culture Collection (Rockville, MD, USA).