Example sentences for: carboxyl

How can you use “carboxyl” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • As seen in Figure 9, both frameshift mutations lead to elimination of a highly conserved motif (NCVpRFaDT) near the carboxyl terminus of the peptide - a region that must be critical to proper function or folding.

  • 3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.

  • Since this region of well-conserved sequence continues unbroken between the NH 2 -extension and the hhhhDxSxS motif, the NH 2 -extension and the carboxyl region of the M-domain probably form two parts of a single structural domain.

  • This heteromerization of the p24 proteins has been shown to require a coiled-coil stretch at the extreme carboxyl terminus of their lumenal regions [ 10].

  • Initial uncoupling of the beta-2 receptor from the G protein after agonist binding is mediated by phosphorylation by G protein-coupled receptor kinase (GRK) of specific residues in the carboxyl tail of the receptor.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast