Words similar to carboxyl
- carbon
- carbon-dating
- carbondale
- carbonizzato
- carboxy-termini
- carboxy-terminus
- carboxy-tetramethyl-rhodamine
- carboxyethyl
- carboxyfluorescein
- carboxykinase
- carboxyl
- carboxyl-activated
- carboxyl-terminal
- carboxyl-termini
- carboxyl-terminus
- carboxylase
- carboxylesterase
- carboxymethyl-
- carboxymethyl-lysine
- carbón
Example sentences for: carboxyl
How can you use “carboxyl” in a sentence? Here are some example sentences to help you improve your vocabulary:
As seen in Figure 9, both frameshift mutations lead to elimination of a highly conserved motif (NCVpRFaDT) near the carboxyl terminus of the peptide - a region that must be critical to proper function or folding.
3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.
Since this region of well-conserved sequence continues unbroken between the NH 2 -extension and the hhhhDxSxS motif, the NH 2 -extension and the carboxyl region of the M-domain probably form two parts of a single structural domain.
This heteromerization of the p24 proteins has been shown to require a coiled-coil stretch at the extreme carboxyl terminus of their lumenal regions [ 10].
Initial uncoupling of the beta-2 receptor from the G protein after agonist binding is mediated by phosphorylation by G protein-coupled receptor kinase (GRK) of specific residues in the carboxyl tail of the receptor.
Loading...