Words similar to cac
- ca-dependent
- ca-free
- ca-release
- ca-selective
- cab
- cabg
- cabgs
- cable
- cabp-
- cabras
- cabrera
- cabrillo
- cabrini
- cabs
- caburní
- cac
- cacaaaccaacaaaacccaaa-
- cacaagcgc-
- cacacaaaacctacaaaaaatca-
- cacagccaggatggatccatggtcataggt
- cacagccaggatggatcctcaatggtcatagg
- cacahuate
- cacaluta
- cacco
- cacela
- cacet
- cacheris
- cacl
- caco
Example sentences for: cac
How can you use “cac” in a sentence? Here are some example sentences to help you improve your vocabulary:
Progesterone concentrations were determined by a solid-phase radioimmunoassay (CAC Progesterone, Diagnostic Products Corp, Los Angeles, CA) validated for measuring progesterone in the culture media.
Sequence searches initiated with the conserved globular region of the eukaryotic RAD52 proteins readily detected their homologs from other eukaryotes and, at convergence, also retrieved from the database certain bacterial proteins, such as DR0423 from Deinococcus and CAC1936 from Clostridium respectively, with border-like statistical significance (e ~ .05).
Even the closest relatives of the GSPSs, namely MM2478 and CAC1526, are secreted proteins that are likely to function as extracellular peptidases.
Briefly, genomic DNA (50 ng) was amplified using 50 pmol primers (5'-CAT TCG CAC TCT GGA GTC-3' and 5'-AGG CTC TTG GGG TAC TTG-3') in GeneAmp PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 0.001% [w/v] gelatin, 1.5 mM MgCl
A full length, 1.2 kb IDO cDNA was amplified from IFN-γ stimulated RAW cells and cloned into pGEM T-Easy (Promega), using primers; 5' TAG CGG CCG CGT AGA CAG CAA TGG CAC TC 3' forward, 5' TAA GAT CTT ACA CTA AGG CCA ACT CAG 3' reverse, which contain Not I and Bgl II sites respectively.
Loading...