Words similar to cac
- ca-dependent
- ca-free
- ca-release
- ca-selective
- cab
- cabg
- cabgs
- cable
- cabp-
- cabras
- cabrera
- cabrillo
- cabrini
- cabs
- caburní
- cac
- cacaaaccaacaaaacccaaa-
- cacaagcgc-
- cacacaaaacctacaaaaaatca-
- cacagccaggatggatccatggtcataggt
- cacagccaggatggatcctcaatggtcatagg
- cacahuate
- cacaluta
- cacco
- cacela
- cacet
- cacheris
- cacl
- caco
Example sentences for: cac
How can you use “cac” in a sentence? Here are some example sentences to help you improve your vocabulary:
The introns were PCR-amplified with KM37 (GAT AAT ACG ACT CAC TAT AAT GGC ATT ACC GCC TTG T) and GM24 (GCT CTA GAC TTA GCT ACA ATA TGA AC) in 25 μl reactions under the conditions stated above and cycled 20 times.
Progesterone concentrations were determined by a solid-phase radioimmunoassay (CAC Progesterone, Diagnostic Products Corp, Los Angeles, CA) validated for measuring progesterone in the culture media.
This search (expect value (e) threshold for inclusion in profile = 0.01) recovered, in addition to the orthologs of the PRC-H proteins from other purple proteobacteria, several uncharacterized proteins from the cyanobacterium Anabaena (for example, all5315 and alr5332, iteration 2, e = 10 -6-10 -4), non-photosynthetic α-proteobacteria such as Mesorhizobium, Sinorhizobium, Brucella and Caulobacter (for example, SMc00885, iteration 4, e = 10 -4or CAC1676, iteration 5, e = 10 -6), several other assorted bacteria like Deinococcus, Bacillus and Streptomyces (for example, YlmC iteration 4, e = 10 -5) and several archaea with completely sequenced genomes.
Briefly, genomic DNA (50 ng) was amplified using 50 pmol primers (5'-CAT TCG CAC TCT GGA GTC-3' and 5'-AGG CTC TTG GGG TAC TTG-3') in GeneAmp PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 0.001% [w/v] gelatin, 1.5 mM MgCl
MI01406.cl and MI00267.cl show homology to two hypothetical proteins from the Actinomycetales - Amycolatopsis mediterranei CAC42207 (5e-29) and Streptomyces lavendulae AAD32751 (2e-24).
Loading...