Example sentences for: cacagccaggatggatccatggtcataggt

How can you use “cacagccaggatggatccatggtcataggt” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The extracellular domain (amino acid residues Glu 24-His 159) of monkey proHB-EGF (GenBank accession number Q09118) [ 2 ] was amplified by PCR using primers MkHB-EGF ex (5') TCGGCACTGGTGGAATTCGAGAGCCTGGAG and MKHB-EGF ex (3') CACAGCCAGGATGGATCCATGGTCATAGGT.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast