Words similar to aj

Example sentences for: aj

How can you use “aj” in a sentence? Here are some example sentences to help you improve your vocabulary:

In a series of 250 injections with a survival rate of 55% and an expression rate of 30% AJ/Pst was also specifically expressed in myocytes (see figure 7).
In this construct, which was named AJ/Pst, intron 1b, exon 1b' and most of intron 1c, totalling 3.6 KB, are eliminated.
O'Malley SS, Jaffe AJ, Chang G, Rode S, Schottenfeld R, Meyer RE, Rounsaville B. Six-month follow-up of Naltrexone and psychotherapy for alcohol dependence.
In two series of injections 350 embryos were injected with AJ.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.