Words similar to aj
Example sentences for: aj
How can you use “aj” in a sentence? Here are some example sentences to help you improve your vocabulary:
Along this line, BLAST searches in bacteria databases disclosed, in one incompletely sequenced bacterial genome ( Paenibacillus azotofixans ), an open reading frame (nt 3822 to 4583 in the AJ299453 genomic clone) which contains almost all and displays significant similarity with the yCCR4 C-terminal region, but does not contain a LRR nor a N-terminal domain.
This construct was named AJ.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.
In this construct, which was named AJ/Pst, intron 1b, exon 1b' and most of intron 1c, totalling 3.6 KB, are eliminated.
Graphina poitiaei , AF465459), 1071 ( Rhynchostoma minutum , AF242268), 1083 ( Rhamphoria delicatula , AF242267), 1226 ( Rhynchostoma minutum , AF242269), 1229 ( Physconia perisidiosa , AJ421689), and 1514 ( Phialophora americana , X65199); LSU rRNA - 678 ( Gyalecta jenensis , AF279391), 681 ( Stictis radiata , AF356663), 711 ( Gyalecta jenensis , AF279391), 775 ( Dibaeis baeomyces , AF279385), 776 ( Capronia pilosella , AF279378), 777 ( Rinodina tunicata , AF457569), 780 ( Pertusaria tejocotensis , AF279301), 784 ( Melanochaeta sp. 8, AF279421), 786 ( Pertusaria kalelae , AF279298), 787 ( Dibaeis baeomyces , AF279385), 824 ( Stictis radiata , AF356663), 830 ( Coenogonium leprieurii , AF465442), 858 ( Trapeliopsis granulosa , AF279415), 978 ( Gyalecta jenensis , AF279391), 1024 ( Ocellularia alborosella , AF465452), 1054 ( Rinodina tunicata , AF457569), 1091 ( Dimerella lutea , AF279387), 1093 (
Loading...