Words similar to aj

Example sentences for: aj

How can you use “aj” in a sentence? Here are some example sentences to help you improve your vocabulary:

For example, Z30 small nucleolar RNA [ 16] (accession number: AJ007733), located at human chr17: 34803858-34803954, is a methylation guide molecule for U6 snRNA.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.
O'Malley SS, Jaffe AJ, Chang G, Rode S, Schottenfeld R, Meyer RE, Rounsaville B. Six-month follow-up of Naltrexone and psychotherapy for alcohol dependence.
Together, the fungal spliceosomal data set included 49 different introns at the following sites (the species from which they were isolated and GenBank accession numbers, where available, are also shown): SSU rRNA - 265 ( Arthroraphis citrinella , AF279375), 297 ( Anaptychia runcinata , AJ421692), 298 ( Physconia perisidiosa , AJ421689), 299 ( Roccella canariensis , AF110342), 300 ( Rhynchostoma minutum , AF242268), 330 ( Stereocaulon paschale , AF279412), 331 ( Physconia perisidiosa , AJ421689), 332 ( Pyrenula cruenta , AF279406), 333 (
Smith AJ, Shepherd JP, Hodgson RJ.