Words similar to aj

Example sentences for: aj

How can you use “aj” in a sentence? Here are some example sentences to help you improve your vocabulary:

Five of the remaining families (AJ, AH, T, BC, CT) showed haplotype data inconsistent with linkage to FEOM3, but the theta values obtained at lod scores of -2 were insufficient to rule out the entire FEOM3 critical region.
In a few embryos AJ was also expressed in notochord and vascular cells.
Primers sets for the epithelial calcium channel were as follows: sense primer 5'TGAACCTGGTGCGCGCACTGC3' (GenBank accession number AJ271207.
O'Malley SS, Jaffe AJ, Chang G, Rode S, Schottenfeld R, Meyer RE, Rounsaville B. Six-month follow-up of Naltrexone and psychotherapy for alcohol dependence.
The SSU 674 site ( Physconia detersa , AJ240495), for example, only included 10 nt of the 5' and 3' region in the GenBank accession [ 11 ] . All fungal and diatom intron sites were, however, mapped on the conservation diagrams to understand their distribution (see below).