Words similar to af

Example sentences for: af

How can you use “af” in a sentence? Here are some example sentences to help you improve your vocabulary:

PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).
EGFP was imaged with an FITC filter set, while ECFP was distinguished from EGFP in co-expression experiments by changing both the excitation and emission filter sets (Exciters: 440AF21 & 500AF25, Dichroic cat# XF 2063, Emitters 480AF & 545AF35; Omega, Brattleboro, VT).
Analogous searches of mouse D H (AF018146) and DJβ (AE000665) regions also demonstrated RIC 12 values for physiologic RSS above threshold (Table 6).
The single archaeal fusion, the Arachaeoglobus fulgidus protein AF0227, belongs to one of these clusters and shows a strongly supported affinity with the ortholog from the hyperthermophilic bacterium Thermotoga maritima . (Figure 4a,4b).
The previously reported partial MmCOP1 mRNA (GenBank accession number AF151110.