Words similar to af
Example sentences for: af
How can you use “af” in a sentence? Here are some example sentences to help you improve your vocabulary:
Two types of Ul region were identified that displayed some sequence difference: Ul1 (5699 bp, GenBank Accession No: AF364090) and Ul2 (5695 bp, GenBank Accession No: AF364091).
In Giardia intestinalis, it comprises a polypeptide of 4835 amino acids (accession AF494287; MM 540 kDa).
PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).
Fibulin-1 is a calcium-binding extracellular matrix glycoprotein that is associated with various connective tissues, basement membranes and blood [ 37 38 39 ] . Splicing of the C terminal domain of fibulin-1 can lead to the expression of different variants of fibulin-1 (A-D) [ 37 ] . The amino acid sequence of the human fibulin-1C protein encodes five domains: a signal sequence (35 amino acid residues), three anaphylatoxin type I repeats (108 residues), an adjoining sequence (33 amino acid residues), nine calcium-binding type II EGF-like modules (387 amino acid residues), and a carboxyl domain (116 amino acid residues) [ 37 ] . The amino acid sequence derived from the nucleotide sequence obtained for monkey fibulin-1C (GenBank accession number AF395659) shows it to share 97.
The same, however, cannot be said either of the recent and increasingly common af flu ence, barely, if at all, distinguishable from the similarly mis-stressed ef flu ents, or of defuse , when a failure to place nearly equal emphasis on both syllables leads to the word's being mistaken for the verb diffuse .
Loading...