Words similar to af

Example sentences for: af

How can you use “af” in a sentence? Here are some example sentences to help you improve your vocabulary:

The GenBank accession number for the M. paratuberculosis 11-kb oriC region is AF222789.
McNeil, he added, still donates more than $1 million annually to the AF.
Additional members of this group include two ORFs containing Duffy-like binding domains, erythrocyte-binding antigen, EBA 175 (L07755), a putative erythrocyte-binding protein, EBL1 (AF131999), and proteins known to be delivered to the surface from apical organelles, including apical membrane antigen, AMA1 (U65407), and finally two rhoptry-associated proteins (RAP1 (U20985) and RAP2).
In this instance, BLASTX, GenBank/EMBL/DDBJ, and cDNA records indicate that the 3' half of CG8278 should be split off as a separate gene model ( CG30350 ), while the GenBank:AF254867 record indicates that the 5' exon of CG8278 plus six other Release 2 annotations should be merged into the extensive sns annotation.
PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).