Words similar to acs

Example sentences for: acs

How can you use “acs” in a sentence? Here are some example sentences to help you improve your vocabulary:

(Note that this C-R function is based on the original air quality dataset used in the ACS study, covering 50 cities, and used the median PM2.
Partially purified protein fractions containing GSTCdc6 or GST contain an ACS binding activity
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
In S. cerevisiae , ACS elements have been reported to be essential for ORC binding and replication initiation.
ARSb, c and d contain at least one ACS like element (Fig.