Example sentences for: acs

How can you use “acs” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.

  • Partially purified fractions (reduced glutathione eluate) containing GSTCdc6 or GST showed an ACS binding activity in an ATP dependent manner.

  • (Note that this C-R function is based on the original air quality dataset used in the ACS study, covering 50 cities, and used the median PM2.

  • Therefore the ACS sequence is essential for the p35-DNA protein complex formation.

  • , 1993) and the "American Cancer Society or ACS study" (Pope et al.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast