Example sentences for: acs

How can you use “acs” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The ACS says its surveys show that the public supports such contracts, so long as they raise plenty of money for the charity and don't conflict with its basic mission.

  • Krewski/ACS Study Regional 7,300 +$5.

  • 8) which could be competed out using a 50 bp long double stranded oligo containing two ACS like elements (oligo 'b', Fig.

  • This polypeptide bound to yeast ACS like elements in the presence of ATP.

  • Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast