Words similar to vdr

Example sentences for: vdr

How can you use “vdr” in a sentence? Here are some example sentences to help you improve your vocabulary:

The role of VDR gene polymorphisms has been examined in four groups of diabetic patients, however their roles in insulin sensitivity have not been examined.
In the present study, we report an association between a polymorphism at the translation initiation codon of the human VDR gene and insulin sensitivity in glucose tolerant and normotensive Caucasians.
The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.
Subsequently, the VDR gene polymorphisms were found to account for 75% of the total genetic effect on BMD in healthy people [ 8].
HOMA, Homeostasis Model Assessment; VDR, vitamin D receptor; BMD, bone mineral density; PCR, polymerase chain reaction.