Words similar to vdr

Example sentences for: vdr

How can you use “vdr” in a sentence? Here are some example sentences to help you improve your vocabulary:

However, to date there are more than 50 studies on the relationship between VDR gene polymorphisms and BMD [ 9].
Subsequently, the VDR gene polymorphisms were found to account for 75% of the total genetic effect on BMD in healthy people [ 8].
The study of type 2 diabetes with the VDR gene included 164 Bangladesh Asians who were at risk for type 2 diabetes and 25% of them were either diabetic or impaired glucose tolerant.
The genomic DNA fragment flanking the Fok I polymorphism was amplified using two primers flanking exon 2 of the VDR gene: AGCTGGCCCTGGCACTGCTCTGCTCT and ATGGAAACACCTTGCTTCTTCTCCCTC.
In this regard, SI, lactase, and the receptor for 1,25 OH-VitD3 (VDR) share transcriptional regulation through the homeodomain transcription factor CDX2 [ 33 34 ] . The possibility that SI or lactase deficiency could cause secondary up-regulation of VDR awaits exploration in cell culture or animal models.