Words similar to ul

Example sentences for: ul

How can you use “ul” in a sentence? Here are some example sentences to help you improve your vocabulary:

cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.
3 × 10 5) suspended in 600 ul media were incubated at 37°C overnight in 6% CO 2 with anti-CD3 (1:500 dilution of acetates fluid) and PMA (2.
To every vial 60 ul of deionized water were added.
Purified PCR products were dried down and resuspended in 80 ul 3X SSC (standard saline citrate- 1X SSC = 150 mM NaCl, 15 mM sodium citrate) with 0.01% sodium dodecyl sulfate (SDS).
After being air dried, each chamber was covered with 50 ul of a 1:50 dilution of DEN2-specific hyperimmune mouse ascitic fluid (HMAF, American Type Culture Collection) in PBS plus 2% normal goat serum and incubated at room temperature for 1 h in a humidified atmosphere and then rinsed twice in PBS.