Words similar to ttg
- tsíps
- tta
- ttagtttttcggtttactaaatcgtaatagaaatgtagaacaataaaatgt
- ttc
- ttcactggaccagcataagga-
- ttcgctggtcaatggttcaa-
- ttctcaccttaatggagctatac
- ttctcctacagattgtacaaatgtgg-
- ttctgctctggttctgcatg
- ttcttcaacagcaccactcgtc
- ttg
- ttg-
- ttg---
- ttgaca-
- ttgaccugaaggucuucuugu
- ttgat
- ttgcgggccatatccttg
- ttgttgccacgtgggcg
- tthe
- ttn
- tto
- ttorneys
- tttttt
- ttttttaatttgctgctttctttttttcc
- tttttttttttttttv-
- ttx
- tty
- tu
- tug
- tugs
- tuj
Example sentences for: ttg
How can you use “ttg” in a sentence? Here are some example sentences to help you improve your vocabulary:
QUASI performs this procedure for all replacement point mutations [ e.g. , in the example case, Tyr (tat), Ile (att), Leu (tta, ttg, and ctt), Val (gtt), Ser (tct), and Cys (tgt)].
Briefly, genomic DNA (50 ng) was amplified using 50 pmol primers (5'-CAT TCG CAC TCT GGA GTC-3' and 5'-AGG CTC TTG GGG TAC TTG-3') in GeneAmp PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 0.001% [w/v] gelatin, 1.5 mM MgCl
The double stranded oligos used were as follows: for the Ets binding site on the CD5 promoter, 5' CGC GTA CAG GGA GGA AGT TGA CCT CGA 3'; for the oligonucleotides containing the CD5X region, 5' AGG CCT AAG TTG ACA GTT CAA CTT CAA ACA CTC GAG 3'; and for the CD5Y oligo, 5' AGG CCT CAC AGG CCC ACA CTG CCT GCT TCC CTG GAG 3'.
The primers (5' or 3') used for COX-2 were sense primer, CAT TCT TTG CCC AGC ACT TCA C and antisense primer, GAC CAG GCA CCA AGA CCA AAG AC.
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.