Example sentences for: ttttttaatttgctgctttctttttttcc

How can you use “ttttttaatttgctgctttctttttttcc” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The combination of primer A and the primer 5'TTTTTTAATTTGCTGCTTTCTTTTTTTCC 3'(Fig.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast