Words similar to transcription-polymerase

Example sentences for: transcription-polymerase

How can you use “transcription-polymerase” in a sentence? Here are some example sentences to help you improve your vocabulary:

Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
RNA extraction and quantitative reverse transcription-polymerase chain reaction
Prostaglandin E 2 (PGE 2 ); cortical thick ascending limb (cTAL); thin descending limb of Henle's loop (tDL); cortical and outer medullary collecting ducts (CCD, OMCD); reverse transcription-polymerase chain reaction (RT-PCR)
BAL = bronchoalveolar lavage; BSA = bovine serum albumin; C/EBP = CCAAT/enhancer binding protein; COX-2 = cyclooxygenase-2; CREB = cAMP response element binding protein; FBS = fetal bovine serum; fMLP = n-formyl-methionyl-leucyl-phenylalanine; HBSS = Hank's balanced salt solution; ICAM-1 = intercellular adhesion molecule-1; LPS = lipoplysaccharide; MAP = mitogen activated protein; MIP-2 = macrophage inflammatory protein-2; NF-κB = nuclear factor-kappa B; PBS = phosphate-buffered saline; PI3K = phosphatidyl inositol 3 kinase; PKB = protein kinase B; RT-PCR = Reverse transcription-polymerase chain reaction; TBE = Tris borate EDTA; TNF-α = tumor necrosis factor alpha