Words similar to tgcttcctccatttggcgaac
Example sentences for: tgcttcctccatttggcgaac
How can you use “tgcttcctccatttggcgaac” in a sentence? Here are some example sentences to help you improve your vocabulary:
The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).
Loading...