Words similar to sey

Example sentences for: sey

How can you use “sey” in a sentence? Here are some example sentences to help you improve your vocabulary:

The HNT2 gene was amplified from genomic DNA of yeast strain SEY6210 [ 48 ] with primers PB1 (5'GCAGCGGATCCTTGGGAT) that spanned a Bam HI site upstream of the promoter and PB2 (5'GAGTCTCCTCGAGGAAAG) that spanned a Xho I site downstream of the terminator.
The S. cerevisiae gene encoding lysyl tRNA synthetase ( KRS1 ) was amplified as a 2.9 kbp genomic fragment from strain SEY6210 using primers MR20 (5'CGAGCTCGGTTGGA TGACTTTAAAATGACTAAGTTTGTAGTATCCTCTTTGC ATACTC) and MR21 (5'TCCCCCGGGGGAGCTCCTTTAGGGCTACCGAACATAAACAAATTTAGGTAA TGAGTTTTC).