Example sentences for: seperate

How can you use “seperate” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).

  • offer Seperate offer (DeMars v.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast