Words similar to radiolabeled
Example sentences for: radiolabeled
How can you use “radiolabeled” in a sentence? Here are some example sentences to help you improve your vocabulary:
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).
Moreover, the rates of decline in the amount of radiolabeled TCA associated with the cells after withdrawal of the radiolabeled bile acids from the culture medium was comparable among the different clones (Figure 9C), indicating that the rate of bile acid efflux from these cells was also not affected by the presence of HBAB.
Human fibrinogen was radiolabeled with 125I (Amersham, Chicago, IL) using Iodobeads (Pierce, Rockford, IL) as described [ 48 ] . Different numbers of bacteria were incubated with 20,000 cpm of 125I labeled fibrinogen for 60 min at 37°C.
Ten of the 17 clones were detected in reverse northern experiments using either brain or body radiolabeled cDNA (Table 6).