Words similar to radiolabeled

Example sentences for: radiolabeled

How can you use “radiolabeled” in a sentence? Here are some example sentences to help you improve your vocabulary:

Immunoprecipitation of the α subunit after increasing times of chase, followed by SDS-PAGE and fluorography revealed that radiolabeled sα i2 was rapidly lost.
The radiolabeled PCR products that reflected the HCDR3 lengths of various B-cell clones in the cell suspension were electrophoresed through a 6% denaturing acrylamide sequencing gel for approximately 1.5 h.
DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).
Because binding of cell-surface receptors to polyethylenimine filters is rather insensitive to ionic strength, the ionic phenomenon is thought to be supplemented by hydrophobic forces and hydrogen binding [ 32 ] . The method used with Y-79 cells and radiolabeled PEDF has been described before in detail [ 18 ] . Briefly, cells cultured overnight in serum-deprived medium at 37°C were transferred to ice/water bath for 10 minutes before the addition of ligand.
Polymerase chain reaction (PCR) products (2 μ l) generated from either genomic DNA or cDNA were amplified using 5 pmol of nested sense V H family-specific FR3 primer and radiolabeled antisense nested J H consensus primer that had been end-labeled with γ 32-P (New England Nuclear, Beverly, MA, USA) using T4 polynucleotide kinase (Promega, Madison, WI, USA).