Words similar to ptu

Example sentences for: ptu

How can you use “ptu” in a sentence? Here are some example sentences to help you improve your vocabulary:

Histological scores also declined significantly from 7.17 ± 2.78 at baseline to 3.00 ± 2.61 at the end of 12 weeks PTU treatment (p < 002).
To make pJC3, we subcloned the Nsi I- Pst I fragment (1246 bp) of pTU23 [ 35] into the Pst I site of pPD118.
Additional studies are being performed which address whether PTU treatment of patients with plaque psoriasis leads to reduced in situ IL-12 expression, alters production of the IL-35 or IL-40 components of the IL-70 heterodimer, as well as exerts an effect by enhancing apoptosis in the proliferated keratinocytes that make up the psoriatic plaque which would result in clinical improvement.
To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.
Biopsy samples were taken from patients at the start and after 3 months of PTU treatment from the same psoriatic lesion.