Words similar to ptu
Example sentences for: ptu
How can you use “ptu” in a sentence? Here are some example sentences to help you improve your vocabulary:
These differentiated cells, although usually stable, sometime exhibit proliferative activity and increase in many cutaneous immune response states [ 23 39 40 ] . The inability of PTU to reduce CD1a expression in biopsy samples of patients with psoriasis suggests that the mechanism of action of this drug is psoriasis is not due to any effect on skin antigen-presenting cells or production of IL-12, a motive cytokine that is responsible for initiation and maintenance of the cytokine stimulatory cascade that leads to formation of the psoriatic plaque [ 16 ] . In support of this argument is the fact that circulating IL-12 did not show any significant change with PTU treatment (submitted).
To make pJC3, we subcloned the Nsi I- Pst I fragment (1246 bp) of pTU23 [ 35] into the Pst I site of pPD118.
Additional studies are being performed which address whether PTU treatment of patients with plaque psoriasis leads to reduced in situ IL-12 expression, alters production of the IL-35 or IL-40 components of the IL-70 heterodimer, as well as exerts an effect by enhancing apoptosis in the proliferated keratinocytes that make up the psoriatic plaque which would result in clinical improvement.
To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.
Biopsy samples were taken from patients at the start and after 3 months of PTU treatment from the same psoriatic lesion.