Example sentences for: ptu

How can you use “ptu” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Biopsy samples were taken from patients at the start and after 3 months of PTU treatment from the same psoriatic lesion.

  • Additional studies are being performed which address whether PTU treatment of patients with plaque psoriasis leads to reduced in situ IL-12 expression, alters production of the IL-35 or IL-40 components of the IL-70 heterodimer, as well as exerts an effect by enhancing apoptosis in the proliferated keratinocytes that make up the psoriatic plaque which would result in clinical improvement.

  • Histological scores also declined significantly from 7.17 ± 2.78 at baseline to 3.00 ± 2.61 at the end of 12 weeks PTU treatment (p < 002).

  • To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.

  • To make pJC3, we subcloned the Nsi I- Pst I fragment (1246 bp) of pTU23 [ 35] into the Pst I site of pPD118.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast