Example sentences for: probed

How can you use “probed” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.

  • To initiate these studies, we performed a co-immunoprecipitation analysis of Pf extracts in which complexes containing PP5 were first precipitated with anti-PP5 antibody and the precipitate then probed with anti-hsp90 antibody in Western blot.

  • Assumption (1) is a fairly general analytical concept, i.e. the closer data is to the measurement threshold, the higher the variability is in that measurement [ 12 19 ] . Assumption (2) appears to be empiricaly valid when surveying the literature for high-density microarray experiments which evaluate severe biological events, from caloric restriction [ 20 21 ] to apoptosis [ 22 23 ] . In these experiments [ 20 21 22 23 ] , regardless of the gene selection method used, less than 5% of the total number of genes probed were differentially regulated.

  • We selected 25 Arg +transformants and analyzed them by Southern blotting for integration of the UAU1 cassette into one of the two CaCET1 chromosomal loci to yield the heterozygote CaCET1/cacet1::UAU1 configuration depicted in Figure 1. Briefly, genomic DNA was isolated from the 25 Arg +strains, then digested with Sca I (which cuts neither CaCET1 nor UAU1 ). The digests were resolved by agarose gel-electrophoresis and transferred to membranes, which were probed with a radiolabeled DNA corresponding to the 5' segment of CaCET1 (probe A in Figure 1).

  • Blots were probed with anti-phosphoserine antibody (Zymed) to determine relative phosphorylation levels of immunoprecipitated RARα.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast