Words similar to probed
Example sentences for: probed
How can you use “probed” in a sentence? Here are some example sentences to help you improve your vocabulary:
Electrophoretic mobility shifts assays were done by mixing a radiolabeled oligonucleotide containing a consensus, high affinity C/EBP binding site (GATCGAGCCCCATTGCGCAATCATAGATC) together with extracts prepared from transfected cells as previously described [ 58 59 ] . Competition with the same, unlabeled oligonucleotide in 1, 10 or 100 molar excess of the radiolabeled probed indicated specific binding.
To initiate these studies, we performed a co-immunoprecipitation analysis of Pf extracts in which complexes containing PP5 were first precipitated with anti-PP5 antibody and the precipitate then probed with anti-hsp90 antibody in Western blot.
Assumption (1) is a fairly general analytical concept, i.e. the closer data is to the measurement threshold, the higher the variability is in that measurement [ 12 19 ] . Assumption (2) appears to be empiricaly valid when surveying the literature for high-density microarray experiments which evaluate severe biological events, from caloric restriction [ 20 21 ] to apoptosis [ 22 23 ] . In these experiments [ 20 21 22 23 ] , regardless of the gene selection method used, less than 5% of the total number of genes probed were differentially regulated.
We selected 25 Arg +transformants and analyzed them by Southern blotting for integration of the UAU1 cassette into one of the two CaCET1 chromosomal loci to yield the heterozygote CaCET1/cacet1::UAU1 configuration depicted in Figure 1. Briefly, genomic DNA was isolated from the 25 Arg +strains, then digested with Sca I (which cuts neither CaCET1 nor UAU1 ). The digests were resolved by agarose gel-electrophoresis and transferred to membranes, which were probed with a radiolabeled DNA corresponding to the 5' segment of CaCET1 (probe A in Figure 1).
Blots were probed with anti-phosphoserine antibody (Zymed) to determine relative phosphorylation levels of immunoprecipitated RARα.
Loading...