Words similar to pricappae
Example sentences for: pricappae
How can you use “pricappae” in a sentence? Here are some example sentences to help you improve your vocabulary:
3) and the carboxyl terminus of monkey fibulin-1C were amplified by PCR using primers Fib5priCAPPAE 5'CGAATTCTGCGCGCCACCTGCTGA and Fib3priFVSAEL 5'CCGTCGACTCAGAGCTCTGCAGACACAAA.
3) of monkey fibulin-1C were amplified by PCR using primers Fib5priYLNDRC 5'CGAATTCTATCTGAATGACCGCTGC and Fib3priCAPPAE 5'CCGTCGACTCACTCAGCAGGTGGCGCGCA.
Loading...