Example sentences for: paired

How can you use “paired” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Under DD conditions, less REMS was present in cry1,2 -/-mice than in cry1,2 +/+mice (119 ± 7 vs. 149 ± 9 min, P < 0.03, unpaired t-test) due to an increase in REMS in cry1,2 +/+mice in DD (149 ± 9 min) relative to LD (113 ± 10 min, P < 0.03, paired t-test).

  • In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).

  • The story also runs on the WP front, while on the USAT front it's paired with news that the government has approved two new anti-breast cancer drugs.

  • In the remaining 45% of the data pairs, which differed by 1.5-fold or more between the two methods, 35% of the paired comparisons were higher by RT-PCR than by microarray, whereas only 10% were higher by microarray than by quantitative PCR.

  • Differential microarray co-hybridization assays measure the relative gene expression of paired query and reference samples, and the power of microarray analysis comes from identification of informative patterns of gene expression across multiple experiments.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast