Words similar to paired
Example sentences for: paired
How can you use “paired” in a sentence? Here are some example sentences to help you improve your vocabulary:
Each category can be searched against a defined set of structural elements, as outlined in Table 5. The structural elements for these nucleotide categories are based on 1) positions that are paired and unpaired and 2) positions at the center or 5' and 3' ends of helices and loops.
Fisher exact test was used for categorical variables and paired Student's t-test was used for continuous parametric variables.
To further test this hypothesis, paired experiments were performed at the single cell level.
Using conditions as above, the sense primer (nt 1932 to nt 1959) was paired with antisense primer 5'TCCAGCTTCTTGGCGATCACAGACTTCTCC3' carrying the point mutation.
Paired two-sample Student's t -tests (Microsoft Excel) were used to determine the degree of [GAG] recovery observed with respect to initial [GAG], before exposure to IL-1.