Example sentences for: oligos

How can you use “oligos” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The double stranded oligos used were as follows: for the Ets binding site on the CD5 promoter, 5' CGC GTA CAG GGA GGA AGT TGA CCT CGA 3'; for the oligonucleotides containing the CD5X region, 5' AGG CCT AAG TTG ACA GTT CAA CTT CAA ACA CTC GAG 3'; and for the CD5Y oligo, 5' AGG CCT CAC AGG CCC ACA CTG CCT GCT TCC CTG GAG 3'.

  • To measure the extent to which the energy calculation implemented in ArrayOligoSelector matches reality, we have plotted in Figure 3the calculated energy of the 100 control oligos shown in Figure 4and their relative intensities of hybridization.

  • The CAS peptide was transferred to pLexA as follows: Two complementary oligos which encoded the 11 amino acid CAS peptide (oVT2899: AATTCTGGAGCTTCTGGATCCAAGAATGGAATCAAAGTTAAG, and oVT2900: GGCCGCTTAACTTTGATTCCATTCTTGGATCCAGAAGCTCCAG) were annealed in PCR buffer and cloned using standard methods into pVT725 via EcoRI and NotI restriction sites.

  • Such tight groups are characteristic of all 45-nucleotide oligos present in this cladogram.

  • We observed two additional endogenous complexes (complex 2 and 3) that were competed away with increasing amount of unlabeled Ets oligos.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast