Words similar to oligonucleotides
- oligofectamine
- oligomers
- oligonucleosomal
- oligonucleotide
- oligonucleotide-based
- oligonucleotide-dependent
- oligonucleotide-derived
- oligonucleotide-directed
- oligonucleotide-selection
- oligonucleotides
- oligopeptide
- oligopeptides
- oligopolies
- oligopolistic
- oligopolists
- oligos
- oligosporus
- oligotex
- olimbos
- olimpico
Example sentences for: oligonucleotides
How can you use “oligonucleotides” in a sentence? Here are some example sentences to help you improve your vocabulary:
The average GC content of the S. cerevisiae oligonucleotides was 31.
This may be achieved by designing exon-specific array features, as well as antisense oligonucleotides.
To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.
Protein-bound oligonucleotides from the fifth round of selection were purified and subcloned into plasmid vectors pCR 2.1 (Invitrogen, Carlsbad, CA).
RT-PCR using oligonucleotides specific to ifkA revealed no ifkA mRNA in these strains (not shown).
Loading...