Words similar to oligonucleotides
- oligofectamine
- oligomers
- oligonucleosomal
- oligonucleotide
- oligonucleotide-based
- oligonucleotide-dependent
- oligonucleotide-derived
- oligonucleotide-directed
- oligonucleotide-selection
- oligonucleotides
- oligopeptide
- oligopeptides
- oligopolies
- oligopolistic
- oligopolists
- oligos
- oligosporus
- oligotex
- olimbos
- olimpico
Example sentences for: oligonucleotides
How can you use “oligonucleotides” in a sentence? Here are some example sentences to help you improve your vocabulary:
Unlabeled DQA1*0101 oligonucleotides successfully competed for strong binding activity seen in nuclear extracts from the Namalwa B cell line (Fig.
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).
Similarly, oligonucleotides gcP1.
At least three specific protein:DNA complexes are formed in EMSA using the CD5X oligonucleotides.
Oligonucleotides, synthesized by Sigma Genosys http://www.sigmagenosys.com/, were designed to amplify the complete coding region of each open reading frame from the sequenced genome of Synechocystis PCC6803.
Loading...