Words similar to ned
Example sentences for: ned
How can you use “ned” in a sentence? Here are some example sentences to help you improve your vocabulary:
The fragment sizes of the FAM, JOE, and NED labeled fragments between 45 and 900 bp were calculated from the raw data relative to the ROX size marker by the GeneScan program (Applied Biosystems) and exported as text files.
Movie -- Waking Ned Devine ;
Waking Ned Devine might have been a snooze if Jones hadn't stocked it with a slew of old actors with magically lived-in visages.
The forward primer was synthesized with one of three fluorescent dyes - HEX (green), NED (yellow), or 6-FAM (blue) (Table 2), covalently bound to the 5' end of the primer (Applied Biosystems, Foster City, CA).
Double stranded, fluorescently labelled (FAM, JOE, or NED) oligonucleotides (5' labelled oligonucleotide: CAGGAGATGCTGTTCGTAGG, unlabelled oligonucleotide: ACGAACAGCATCTCCT, supplier: Applied Biosystems) were annealed in 10 mM Tris pH 8.0, 10 mM NaCl, and 1 mM EDTA (3 min. at 94°C, cooling to 20°C within 15 minutes).